Incidental Mutation 'R7513:Cd84'
ID582191
Institutional Source Beutler Lab
Gene Symbol Cd84
Ensembl Gene ENSMUSG00000038147
Gene NameCD84 antigen
SynonymsCDw84, A130013D22Rik, SLAMF5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7513 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171839697-171890718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 171884618 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 267 (V267E)
Ref Sequence ENSEMBL: ENSMUSP00000047024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042302] [ENSMUST00000136479] [ENSMUST00000155802]
Predicted Effect probably benign
Transcript: ENSMUST00000042302
AA Change: V267E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047024
Gene: ENSMUSG00000038147
AA Change: V267E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136479
AA Change: V266E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122951
Gene: ENSMUSG00000038147
AA Change: V266E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155802
AA Change: V267E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120881
Gene: ENSMUSG00000038147
AA Change: V267E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of this gene show defects in T follicular helper function and germinal center formation. Mice homozygous for a different knock-out allele display normal platelet physiology and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,272,071 G1709R unknown Het
Abcb1a G A 5: 8,715,771 W694* probably null Het
Accs T C 2: 93,840,092 N256S possibly damaging Het
Agmo C T 12: 37,244,353 T100I probably benign Het
Alox8 T C 11: 69,187,844 D341G probably benign Het
Apol7c T A 15: 77,525,711 E345V possibly damaging Het
Arl5a A G 2: 52,412,145 F86L possibly damaging Het
AU040320 A G 4: 126,792,264 E211G probably benign Het
B020011L13Rik T A 1: 117,801,419 C219S probably damaging Het
Btaf1 T A 19: 36,978,403 L579Q probably benign Het
Clec11a T C 7: 44,306,356 E89G probably benign Het
Csrnp2 C A 15: 100,482,416 E331D probably benign Het
Cyp2d12 C A 15: 82,558,420 H355N probably benign Het
D3Ertd254e T A 3: 36,164,643 F272I possibly damaging Het
Ddx24 C A 12: 103,419,106 G413* probably null Het
Dhx38 G A 8: 109,560,589 P249L probably benign Het
Dip2a A T 10: 76,313,235 M233K probably benign Het
Dip2b T A 15: 100,207,748 probably null Het
Dmbt1 T C 7: 131,090,512 S1003P unknown Het
Dna2 A G 10: 62,971,968 D1033G probably benign Het
Dnah5 T C 15: 28,370,415 S2834P probably benign Het
Dnah7b T G 1: 46,124,346 S437A probably benign Het
Eif5 A T 12: 111,540,252 I93F probably damaging Het
Fbxo47 A G 11: 97,856,229 F337S probably damaging Het
Gm8765 T A 13: 50,702,873 I849N probably benign Het
Helz T C 11: 107,656,115 I1086T probably damaging Het
Ifi208 A T 1: 173,695,654 R497* probably null Het
Igfn1 T G 1: 135,959,967 D2453A probably damaging Het
Ighg2c A T 12: 113,288,851 L27Q Het
Jak1 C T 4: 101,191,651 C10Y probably damaging Het
Kif7 T A 7: 79,711,028 N200Y possibly damaging Het
Ktn1 G C 14: 47,664,084 A100P possibly damaging Het
Lrsam1 T C 2: 32,953,485 D136G probably benign Het
Man2c1 T C 9: 57,139,399 L648P probably benign Het
Mki67 T C 7: 135,693,223 I3116V probably benign Het
Mmp10 A T 9: 7,508,127 D418V probably damaging Het
Mrpl24 A T 3: 87,922,427 T107S probably benign Het
Mycbpap T A 11: 94,503,556 D296V probably damaging Het
Mycn C A 12: 12,939,742 A218S probably benign Het
Myo1f G T 17: 33,575,814 W9C probably damaging Het
Nckap1 T A 2: 80,502,291 K1074N possibly damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nhsl1 T C 10: 18,523,952 S275P probably damaging Het
Olfr180 T A 16: 58,915,932 K236N probably damaging Het
Olfr709-ps1 A G 7: 106,927,276 F61S possibly damaging Het
Pam G A 1: 97,853,185 P514S possibly damaging Het
Pcdha4 C T 18: 36,953,339 L192F probably damaging Het
Per1 T A 11: 69,105,571 D800E probably benign Het
Plcg2 C A 8: 117,579,853 N315K probably damaging Het
Plxnb2 T A 15: 89,158,322 probably null Het
Pnpla1 A G 17: 28,858,807 probably benign Het
Pptc7 A T 5: 122,308,129 probably null Het
Psg26 G T 7: 18,475,300 S394R probably benign Het
Psmc1 C A 12: 100,115,514 T125K probably benign Het
Ptgis T A 2: 167,225,283 M125L probably benign Het
Rbms1 A G 2: 60,758,821 Y323H probably damaging Het
Rgl2 G A 17: 33,932,555 R191Q probably benign Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Sirpb1b C A 3: 15,542,140 E361* probably null Het
Slc13a4 A T 6: 35,283,337 probably null Het
Spag9 T C 11: 94,112,083 S1140P probably damaging Het
Tas2r137 A G 6: 40,492,150 N305D probably damaging Het
Tenm2 G A 11: 36,051,900 A1314V probably benign Het
Tgm3 A G 2: 130,024,404 T81A probably benign Het
Timeless T C 10: 128,249,530 V839A probably damaging Het
Tmem132a A G 19: 10,860,128 I606T probably damaging Het
Tox T A 4: 6,741,507 M158L probably benign Het
Trpc2 A T 7: 102,090,068 M549L probably damaging Het
Trpm5 C T 7: 143,081,835 R600Q possibly damaging Het
Trpv1 A G 11: 73,240,541 N302D probably damaging Het
Ttn C T 2: 76,851,596 R1019H Het
Ttn G T 2: 76,944,963 H1958N unknown Het
Usp32 A T 11: 85,027,112 Y769* probably null Het
Vim A T 2: 13,578,632 Q255L possibly damaging Het
Vmn1r84 T C 7: 12,362,067 H233R probably benign Het
Xirp2 T A 2: 67,510,764 H1116Q possibly damaging Het
Zc3h18 G T 8: 122,408,254 R580L unknown Het
Zfp442 A T 2: 150,408,756 C409S unknown Het
Zfy1 A T Y: 759,852 I20K unknown Het
Other mutations in Cd84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cd84 APN 1 171852137 critical splice donor site probably null
IGL01371:Cd84 APN 1 171886370 missense probably benign 0.36
IGL03035:Cd84 APN 1 171852034 missense probably damaging 0.99
IGL03098:Cd84 APN 1 171872700 missense possibly damaging 0.78
R0511:Cd84 UTSW 1 171872927 missense probably benign 0.00
R1244:Cd84 UTSW 1 171851830 missense probably damaging 0.99
R1438:Cd84 UTSW 1 171852118 missense probably damaging 1.00
R1459:Cd84 UTSW 1 171851943 missense probably benign 0.02
R1654:Cd84 UTSW 1 171884606 missense possibly damaging 0.69
R1658:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1659:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1765:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1771:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1776:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1799:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1815:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1816:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1982:Cd84 UTSW 1 171884585 splice site probably null
R1990:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2056:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2057:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2058:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2098:Cd84 UTSW 1 171885581 missense probably benign 0.07
R4674:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4675:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4806:Cd84 UTSW 1 171852121 missense probably benign 0.00
R4828:Cd84 UTSW 1 171872748 missense probably damaging 0.97
R4908:Cd84 UTSW 1 171872865 missense probably damaging 0.96
R5366:Cd84 UTSW 1 171873305 missense probably damaging 1.00
R5725:Cd84 UTSW 1 171873361 missense probably benign 0.00
R5883:Cd84 UTSW 1 171872838 missense possibly damaging 0.58
R6722:Cd84 UTSW 1 171872777 missense probably damaging 0.98
R6966:Cd84 UTSW 1 171886409 missense possibly damaging 0.93
R7733:Cd84 UTSW 1 171840659 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- CACCTGTAATCCTTCGGATGG -3'
(R):5'- GGGATCAATTCCTTAGCATGGTG -3'

Sequencing Primer
(F):5'- CTTCGGATGGAAGGAGCACC -3'
(R):5'- CAATTCCTTAGCATGGTGTTTCTTTG -3'
Posted On2019-10-17