Incidental Mutation 'R7513:Zfp442'
ID582204
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Namezinc finger protein 442
SynonymsOTTMUSG00000015730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7513 (G1)
Quality Score138.008
Status Not validated
Chromosome2
Chromosomal Location150407141-150451486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150408756 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 409 (C409S)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
Predicted Effect unknown
Transcript: ENSMUST00000109916
AA Change: C409S
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: C409S

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185796
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,272,071 G1709R unknown Het
Abcb1a G A 5: 8,715,771 W694* probably null Het
Accs T C 2: 93,840,092 N256S possibly damaging Het
Agmo C T 12: 37,244,353 T100I probably benign Het
Alox8 T C 11: 69,187,844 D341G probably benign Het
Apol7c T A 15: 77,525,711 E345V possibly damaging Het
Arl5a A G 2: 52,412,145 F86L possibly damaging Het
AU040320 A G 4: 126,792,264 E211G probably benign Het
B020011L13Rik T A 1: 117,801,419 C219S probably damaging Het
Btaf1 T A 19: 36,978,403 L579Q probably benign Het
Cd84 T A 1: 171,884,618 V267E probably benign Het
Clec11a T C 7: 44,306,356 E89G probably benign Het
Csrnp2 C A 15: 100,482,416 E331D probably benign Het
Cyp2d12 C A 15: 82,558,420 H355N probably benign Het
D3Ertd254e T A 3: 36,164,643 F272I possibly damaging Het
Ddx24 C A 12: 103,419,106 G413* probably null Het
Dhx38 G A 8: 109,560,589 P249L probably benign Het
Dip2a A T 10: 76,313,235 M233K probably benign Het
Dip2b T A 15: 100,207,748 probably null Het
Dmbt1 T C 7: 131,090,512 S1003P unknown Het
Dna2 A G 10: 62,971,968 D1033G probably benign Het
Dnah5 T C 15: 28,370,415 S2834P probably benign Het
Dnah7b T G 1: 46,124,346 S437A probably benign Het
Eif5 A T 12: 111,540,252 I93F probably damaging Het
Fbxo47 A G 11: 97,856,229 F337S probably damaging Het
Gm8765 T A 13: 50,702,873 I849N probably benign Het
Helz T C 11: 107,656,115 I1086T probably damaging Het
Ifi208 A T 1: 173,695,654 R497* probably null Het
Igfn1 T G 1: 135,959,967 D2453A probably damaging Het
Ighg2c A T 12: 113,288,851 L27Q Het
Jak1 C T 4: 101,191,651 C10Y probably damaging Het
Kif7 T A 7: 79,711,028 N200Y possibly damaging Het
Ktn1 G C 14: 47,664,084 A100P possibly damaging Het
Lrsam1 T C 2: 32,953,485 D136G probably benign Het
Man2c1 T C 9: 57,139,399 L648P probably benign Het
Mki67 T C 7: 135,693,223 I3116V probably benign Het
Mmp10 A T 9: 7,508,127 D418V probably damaging Het
Mrpl24 A T 3: 87,922,427 T107S probably benign Het
Mycbpap T A 11: 94,503,556 D296V probably damaging Het
Mycn C A 12: 12,939,742 A218S probably benign Het
Myo1f G T 17: 33,575,814 W9C probably damaging Het
Nckap1 T A 2: 80,502,291 K1074N possibly damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nhsl1 T C 10: 18,523,952 S275P probably damaging Het
Olfr180 T A 16: 58,915,932 K236N probably damaging Het
Olfr709-ps1 A G 7: 106,927,276 F61S possibly damaging Het
Pam G A 1: 97,853,185 P514S possibly damaging Het
Pcdha4 C T 18: 36,953,339 L192F probably damaging Het
Per1 T A 11: 69,105,571 D800E probably benign Het
Plcg2 C A 8: 117,579,853 N315K probably damaging Het
Plxnb2 T A 15: 89,158,322 probably null Het
Pnpla1 A G 17: 28,858,807 probably benign Het
Pptc7 A T 5: 122,308,129 probably null Het
Psg26 G T 7: 18,475,300 S394R probably benign Het
Psmc1 C A 12: 100,115,514 T125K probably benign Het
Ptgis T A 2: 167,225,283 M125L probably benign Het
Rbms1 A G 2: 60,758,821 Y323H probably damaging Het
Rgl2 G A 17: 33,932,555 R191Q probably benign Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Sirpb1b C A 3: 15,542,140 E361* probably null Het
Slc13a4 A T 6: 35,283,337 probably null Het
Spag9 T C 11: 94,112,083 S1140P probably damaging Het
Tas2r137 A G 6: 40,492,150 N305D probably damaging Het
Tenm2 G A 11: 36,051,900 A1314V probably benign Het
Tgm3 A G 2: 130,024,404 T81A probably benign Het
Timeless T C 10: 128,249,530 V839A probably damaging Het
Tmem132a A G 19: 10,860,128 I606T probably damaging Het
Tox T A 4: 6,741,507 M158L probably benign Het
Trpc2 A T 7: 102,090,068 M549L probably damaging Het
Trpm5 C T 7: 143,081,835 R600Q possibly damaging Het
Trpv1 A G 11: 73,240,541 N302D probably damaging Het
Ttn C T 2: 76,851,596 R1019H Het
Ttn G T 2: 76,944,963 H1958N unknown Het
Usp32 A T 11: 85,027,112 Y769* probably null Het
Vim A T 2: 13,578,632 Q255L possibly damaging Het
Vmn1r84 T C 7: 12,362,067 H233R probably benign Het
Xirp2 T A 2: 67,510,764 H1116Q possibly damaging Het
Zc3h18 G T 8: 122,408,254 R580L unknown Het
Zfy1 A T Y: 759,852 I20K unknown Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
R8528:Zfp442 UTSW 2 150409042 missense probably damaging 1.00
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAGGAGACTAGCTTGACATGC -3'
(R):5'- TCATCTTCGAAGGCATCAAAGAATT -3'

Sequencing Primer
(F):5'- GCCACATTGCTCACATTCATAGGG -3'
(R):5'- CGAAGGCATCAAAGAATTCATACTG -3'
Posted On2019-10-17