Incidental Mutation 'R7513:Sirpb1a'
ID 582206
Institutional Source Beutler Lab
Gene Symbol Sirpb1a
Ensembl Gene ENSMUSG00000095788
Gene Name signal-regulatory protein beta 1A
Synonyms 9930027N05Rik, Sirpb1
MMRRC Submission 045586-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7513 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 15436887-15491487 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15476503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 98 (T98I)
Ref Sequence ENSEMBL: ENSMUSP00000141659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099201] [ENSMUST00000192700] [ENSMUST00000194144]
AlphaFold A0A0A6YYP6
Predicted Effect probably benign
Transcript: ENSMUST00000099201
AA Change: T165I

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096807
Gene: ENSMUSG00000095788
AA Change: T165I

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191958
Predicted Effect probably benign
Transcript: ENSMUST00000192700
AA Change: T165I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141504
Gene: ENSMUSG00000095788
AA Change: T165I

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194144
AA Change: T98I

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141659
Gene: ENSMUSG00000095788
AA Change: T98I

DomainStartEndE-ValueType
Pfam:Ig_2 15 66 6.6e-1 PFAM
Pfam:Ig_3 21 52 1.7e-2 PFAM
Pfam:V-set 23 75 1.2e-7 PFAM
IGc1 96 169 4.8e-7 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,765,771 (GRCm39) W694* probably null Het
Accs T C 2: 93,670,437 (GRCm39) N256S possibly damaging Het
Agmo C T 12: 37,294,352 (GRCm39) T100I probably benign Het
Alox8 T C 11: 69,078,670 (GRCm39) D341G probably benign Het
Apol7c T A 15: 77,409,911 (GRCm39) E345V possibly damaging Het
Arl5a A G 2: 52,302,157 (GRCm39) F86L possibly damaging Het
AU040320 A G 4: 126,686,057 (GRCm39) E211G probably benign Het
B020011L13Rik T A 1: 117,729,149 (GRCm39) C219S probably damaging Het
Btaf1 T A 19: 36,955,803 (GRCm39) L579Q probably benign Het
Cd84 T A 1: 171,712,185 (GRCm39) V267E probably benign Het
Cdcp3 G A 7: 130,873,800 (GRCm39) G1709R unknown Het
Clec11a T C 7: 43,955,780 (GRCm39) E89G probably benign Het
Csrnp2 C A 15: 100,380,297 (GRCm39) E331D probably benign Het
Cyp2d12 C A 15: 82,442,621 (GRCm39) H355N probably benign Het
Ddx24 C A 12: 103,385,365 (GRCm39) G413* probably null Het
Dhx38 G A 8: 110,287,221 (GRCm39) P249L probably benign Het
Dip2a A T 10: 76,149,069 (GRCm39) M233K probably benign Het
Dip2b T A 15: 100,105,629 (GRCm39) probably null Het
Dmbt1 T C 7: 130,692,242 (GRCm39) S1003P unknown Het
Dna2 A G 10: 62,807,747 (GRCm39) D1033G probably benign Het
Dnah5 T C 15: 28,370,561 (GRCm39) S2834P probably benign Het
Dnah7b T G 1: 46,163,506 (GRCm39) S437A probably benign Het
Eif5 A T 12: 111,506,686 (GRCm39) I93F probably damaging Het
Fbxo47 A G 11: 97,747,055 (GRCm39) F337S probably damaging Het
Helz T C 11: 107,546,941 (GRCm39) I1086T probably damaging Het
Ifi208 A T 1: 173,523,220 (GRCm39) R497* probably null Het
Igfn1 T G 1: 135,887,705 (GRCm39) D2453A probably damaging Het
Ighg2c A T 12: 113,252,471 (GRCm39) L27Q Het
Jak1 C T 4: 101,048,848 (GRCm39) C10Y probably damaging Het
Kif7 T A 7: 79,360,776 (GRCm39) N200Y possibly damaging Het
Ktn1 G C 14: 47,901,541 (GRCm39) A100P possibly damaging Het
Lrsam1 T C 2: 32,843,497 (GRCm39) D136G probably benign Het
Man2c1 T C 9: 57,046,683 (GRCm39) L648P probably benign Het
Mki67 T C 7: 135,294,952 (GRCm39) I3116V probably benign Het
Mmp10 A T 9: 7,508,128 (GRCm39) D418V probably damaging Het
Mrpl24 A T 3: 87,829,734 (GRCm39) T107S probably benign Het
Mycbpap T A 11: 94,394,382 (GRCm39) D296V probably damaging Het
Mycn C A 12: 12,989,743 (GRCm39) A218S probably benign Het
Myo1f G T 17: 33,794,788 (GRCm39) W9C probably damaging Het
Nckap1 T A 2: 80,332,635 (GRCm39) K1074N possibly damaging Het
Neb T C 2: 52,099,552 (GRCm39) D4766G possibly damaging Het
Nhsl1 T C 10: 18,399,700 (GRCm39) S275P probably damaging Het
Or2d3c A G 7: 106,526,483 (GRCm39) F61S possibly damaging Het
Or5k16 T A 16: 58,736,295 (GRCm39) K236N probably damaging Het
Pam G A 1: 97,780,910 (GRCm39) P514S possibly damaging Het
Pcdha4 C T 18: 37,086,392 (GRCm39) L192F probably damaging Het
Per1 T A 11: 68,996,397 (GRCm39) D800E probably benign Het
Plcg2 C A 8: 118,306,592 (GRCm39) N315K probably damaging Het
Plxnb2 T A 15: 89,042,525 (GRCm39) probably null Het
Pnpla1 A G 17: 29,077,781 (GRCm39) probably benign Het
Pptc7 A T 5: 122,446,192 (GRCm39) probably null Het
Psg26 G T 7: 18,209,225 (GRCm39) S394R probably benign Het
Psmc1 C A 12: 100,081,773 (GRCm39) T125K probably benign Het
Ptgis T A 2: 167,067,203 (GRCm39) M125L probably benign Het
Rbms1 A G 2: 60,589,165 (GRCm39) Y323H probably damaging Het
Rgl2 G A 17: 34,151,529 (GRCm39) R191Q probably benign Het
Sirpb1b C A 3: 15,607,200 (GRCm39) E361* probably null Het
Slc13a4 A T 6: 35,260,272 (GRCm39) probably null Het
Spag9 T C 11: 94,002,909 (GRCm39) S1140P probably damaging Het
Spata31e4 T A 13: 50,856,909 (GRCm39) I849N probably benign Het
Tas2r140 A G 6: 40,469,084 (GRCm39) N305D probably damaging Het
Tenm2 G A 11: 35,942,727 (GRCm39) A1314V probably benign Het
Tgm3 A G 2: 129,866,324 (GRCm39) T81A probably benign Het
Timeless T C 10: 128,085,399 (GRCm39) V839A probably damaging Het
Tmem132a A G 19: 10,837,492 (GRCm39) I606T probably damaging Het
Tox T A 4: 6,741,507 (GRCm39) M158L probably benign Het
Trpc2 A T 7: 101,739,275 (GRCm39) M549L probably damaging Het
Trpm5 C T 7: 142,635,572 (GRCm39) R600Q possibly damaging Het
Trpv1 A G 11: 73,131,367 (GRCm39) N302D probably damaging Het
Ttn C T 2: 76,681,940 (GRCm39) R1019H Het
Ttn G T 2: 76,775,307 (GRCm39) H1958N unknown Het
Usp32 A T 11: 84,917,938 (GRCm39) Y769* probably null Het
Vim A T 2: 13,583,443 (GRCm39) Q255L possibly damaging Het
Vmn1r84 T C 7: 12,095,994 (GRCm39) H233R probably benign Het
Xirp2 T A 2: 67,341,108 (GRCm39) H1116Q possibly damaging Het
Zc3h18 G T 8: 123,134,993 (GRCm39) R580L unknown Het
Zfp267 T A 3: 36,218,792 (GRCm39) F272I possibly damaging Het
Zfp442 A T 2: 150,250,676 (GRCm39) C409S unknown Het
Zfy1 A T Y: 759,852 (GRCm39) I20K unknown Het
Other mutations in Sirpb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sirpb1a APN 3 15,475,788 (GRCm39) unclassified probably benign
IGL00597:Sirpb1a APN 3 15,481,977 (GRCm39) missense probably damaging 1.00
IGL01521:Sirpb1a APN 3 15,475,561 (GRCm39) missense probably benign 0.00
IGL01678:Sirpb1a APN 3 15,476,370 (GRCm39) missense probably damaging 1.00
IGL02154:Sirpb1a APN 3 15,475,504 (GRCm39) missense probably damaging 1.00
IGL02275:Sirpb1a APN 3 15,475,469 (GRCm39) critical splice donor site probably null
IGL02419:Sirpb1a APN 3 15,491,398 (GRCm39) missense probably benign
IGL02657:Sirpb1a APN 3 15,482,111 (GRCm39) missense possibly damaging 0.85
IGL03086:Sirpb1a APN 3 15,491,388 (GRCm39) splice site probably null
PIT4142001:Sirpb1a UTSW 3 15,476,258 (GRCm39) missense probably benign 0.00
R0270:Sirpb1a UTSW 3 15,475,587 (GRCm39) missense probably damaging 1.00
R1975:Sirpb1a UTSW 3 15,444,141 (GRCm39) missense probably benign 0.00
R3432:Sirpb1a UTSW 3 15,491,447 (GRCm39) missense probably damaging 0.98
R4613:Sirpb1a UTSW 3 15,482,097 (GRCm39) missense probably benign 0.09
R5325:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R6223:Sirpb1a UTSW 3 15,444,086 (GRCm39) missense probably benign 0.02
R6526:Sirpb1a UTSW 3 15,444,080 (GRCm39) missense probably damaging 0.99
R6903:Sirpb1a UTSW 3 15,481,984 (GRCm39) missense probably damaging 0.99
R7349:Sirpb1a UTSW 3 15,475,664 (GRCm39) missense probably damaging 0.99
R8250:Sirpb1a UTSW 3 15,444,104 (GRCm39) missense possibly damaging 0.92
R8700:Sirpb1a UTSW 3 15,476,419 (GRCm39) missense probably damaging 0.97
R9263:Sirpb1a UTSW 3 15,481,992 (GRCm39) missense probably damaging 1.00
R9553:Sirpb1a UTSW 3 15,476,320 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACATCCCTAGGTTCCAAC -3'
(R):5'- TGCTTGGACACAGGTATGAC -3'

Sequencing Primer
(F):5'- AACACCACCTGGACTGTGCTG -3'
(R):5'- CAGGTTCCTAGTTGCCTGGTAAC -3'
Posted On 2019-10-17