Mutagenetix > Incidental Mutation

Incidental Mutation 'R7513:Dmbt1'

582222

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin

MMRRC Submission

045586-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R7513 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

130633787-130723357 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130692242 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1003 (S1003P)

Ref Sequence

ENSEMBL: ENSMUSP00000146685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000084509
AA Change: S992P

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: S992P

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000208311
AA Change: S1003P

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213064
AA Change: S829P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	G	A	5: 8,765,771 (GRCm39)	W694*	probably null	Het
Accs	T	C	2: 93,670,437 (GRCm39)	N256S	possibly damaging	Het
Agmo	C	T	12: 37,294,352 (GRCm39)	T100I	probably benign	Het
Alox8	T	C	11: 69,078,670 (GRCm39)	D341G	probably benign	Het
Apol7c	T	A	15: 77,409,911 (GRCm39)	E345V	possibly damaging	Het
Arl5a	A	G	2: 52,302,157 (GRCm39)	F86L	possibly damaging	Het
AU040320	A	G	4: 126,686,057 (GRCm39)	E211G	probably benign	Het
B020011L13Rik	T	A	1: 117,729,149 (GRCm39)	C219S	probably damaging	Het
Btaf1	T	A	19: 36,955,803 (GRCm39)	L579Q	probably benign	Het
Cd84	T	A	1: 171,712,185 (GRCm39)	V267E	probably benign	Het
Cdcp3	G	A	7: 130,873,800 (GRCm39)	G1709R	unknown	Het
Clec11a	T	C	7: 43,955,780 (GRCm39)	E89G	probably benign	Het
Csrnp2	C	A	15: 100,380,297 (GRCm39)	E331D	probably benign	Het
Cyp2d12	C	A	15: 82,442,621 (GRCm39)	H355N	probably benign	Het
Ddx24	C	A	12: 103,385,365 (GRCm39)	G413*	probably null	Het
Dhx38	G	A	8: 110,287,221 (GRCm39)	P249L	probably benign	Het
Dip2a	A	T	10: 76,149,069 (GRCm39)	M233K	probably benign	Het
Dip2b	T	A	15: 100,105,629 (GRCm39)		probably null	Het
Dna2	A	G	10: 62,807,747 (GRCm39)	D1033G	probably benign	Het
Dnah5	T	C	15: 28,370,561 (GRCm39)	S2834P	probably benign	Het
Dnah7b	T	G	1: 46,163,506 (GRCm39)	S437A	probably benign	Het
Eif5	A	T	12: 111,506,686 (GRCm39)	I93F	probably damaging	Het
Fbxo47	A	G	11: 97,747,055 (GRCm39)	F337S	probably damaging	Het
Helz	T	C	11: 107,546,941 (GRCm39)	I1086T	probably damaging	Het
Ifi208	A	T	1: 173,523,220 (GRCm39)	R497*	probably null	Het
Igfn1	T	G	1: 135,887,705 (GRCm39)	D2453A	probably damaging	Het
Ighg2c	A	T	12: 113,252,471 (GRCm39)	L27Q		Het
Jak1	C	T	4: 101,048,848 (GRCm39)	C10Y	probably damaging	Het
Kif7	T	A	7: 79,360,776 (GRCm39)	N200Y	possibly damaging	Het
Ktn1	G	C	14: 47,901,541 (GRCm39)	A100P	possibly damaging	Het
Lrsam1	T	C	2: 32,843,497 (GRCm39)	D136G	probably benign	Het
Man2c1	T	C	9: 57,046,683 (GRCm39)	L648P	probably benign	Het
Mki67	T	C	7: 135,294,952 (GRCm39)	I3116V	probably benign	Het
Mmp10	A	T	9: 7,508,128 (GRCm39)	D418V	probably damaging	Het
Mrpl24	A	T	3: 87,829,734 (GRCm39)	T107S	probably benign	Het
Mycbpap	T	A	11: 94,394,382 (GRCm39)	D296V	probably damaging	Het
Mycn	C	A	12: 12,989,743 (GRCm39)	A218S	probably benign	Het
Myo1f	G	T	17: 33,794,788 (GRCm39)	W9C	probably damaging	Het
Nckap1	T	A	2: 80,332,635 (GRCm39)	K1074N	possibly damaging	Het
Neb	T	C	2: 52,099,552 (GRCm39)	D4766G	possibly damaging	Het
Nhsl1	T	C	10: 18,399,700 (GRCm39)	S275P	probably damaging	Het
Or2d3c	A	G	7: 106,526,483 (GRCm39)	F61S	possibly damaging	Het
Or5k16	T	A	16: 58,736,295 (GRCm39)	K236N	probably damaging	Het
Pam	G	A	1: 97,780,910 (GRCm39)	P514S	possibly damaging	Het
Pcdha4	C	T	18: 37,086,392 (GRCm39)	L192F	probably damaging	Het
Per1	T	A	11: 68,996,397 (GRCm39)	D800E	probably benign	Het
Plcg2	C	A	8: 118,306,592 (GRCm39)	N315K	probably damaging	Het
Plxnb2	T	A	15: 89,042,525 (GRCm39)		probably null	Het
Pnpla1	A	G	17: 29,077,781 (GRCm39)		probably benign	Het
Pptc7	A	T	5: 122,446,192 (GRCm39)		probably null	Het
Psg26	G	T	7: 18,209,225 (GRCm39)	S394R	probably benign	Het
Psmc1	C	A	12: 100,081,773 (GRCm39)	T125K	probably benign	Het
Ptgis	T	A	2: 167,067,203 (GRCm39)	M125L	probably benign	Het
Rbms1	A	G	2: 60,589,165 (GRCm39)	Y323H	probably damaging	Het
Rgl2	G	A	17: 34,151,529 (GRCm39)	R191Q	probably benign	Het
Sirpb1a	G	A	3: 15,476,503 (GRCm39)	T98I	possibly damaging	Het
Sirpb1b	C	A	3: 15,607,200 (GRCm39)	E361*	probably null	Het
Slc13a4	A	T	6: 35,260,272 (GRCm39)		probably null	Het
Spag9	T	C	11: 94,002,909 (GRCm39)	S1140P	probably damaging	Het
Spata31e4	T	A	13: 50,856,909 (GRCm39)	I849N	probably benign	Het
Tas2r140	A	G	6: 40,469,084 (GRCm39)	N305D	probably damaging	Het
Tenm2	G	A	11: 35,942,727 (GRCm39)	A1314V	probably benign	Het
Tgm3	A	G	2: 129,866,324 (GRCm39)	T81A	probably benign	Het
Timeless	T	C	10: 128,085,399 (GRCm39)	V839A	probably damaging	Het
Tmem132a	A	G	19: 10,837,492 (GRCm39)	I606T	probably damaging	Het
Tox	T	A	4: 6,741,507 (GRCm39)	M158L	probably benign	Het
Trpc2	A	T	7: 101,739,275 (GRCm39)	M549L	probably damaging	Het
Trpm5	C	T	7: 142,635,572 (GRCm39)	R600Q	possibly damaging	Het
Trpv1	A	G	11: 73,131,367 (GRCm39)	N302D	probably damaging	Het
Ttn	C	T	2: 76,681,940 (GRCm39)	R1019H		Het
Ttn	G	T	2: 76,775,307 (GRCm39)	H1958N	unknown	Het
Usp32	A	T	11: 84,917,938 (GRCm39)	Y769*	probably null	Het
Vim	A	T	2: 13,583,443 (GRCm39)	Q255L	possibly damaging	Het
Vmn1r84	T	C	7: 12,095,994 (GRCm39)	H233R	probably benign	Het
Xirp2	T	A	2: 67,341,108 (GRCm39)	H1116Q	possibly damaging	Het
Zc3h18	G	T	8: 123,134,993 (GRCm39)	R580L	unknown	Het
Zfp267	T	A	3: 36,218,792 (GRCm39)	F272I	possibly damaging	Het
Zfp442	A	T	2: 150,250,676 (GRCm39)	C409S	unknown	Het
Zfy1	A	T	Y: 759,852 (GRCm39)	I20K	unknown	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	130,681,270 (GRCm39)	intron	probably benign
IGL00161:Dmbt1	APN	7	130,711,357 (GRCm39)	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	130,701,020 (GRCm39)	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	130,684,230 (GRCm39)	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	130,699,337 (GRCm39)	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	130,659,888 (GRCm39)	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	130,687,098 (GRCm39)	splice site	probably benign
IGL01317:Dmbt1	APN	7	130,642,921 (GRCm39)	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	130,690,497 (GRCm39)	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	130,705,409 (GRCm39)	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	130,718,457 (GRCm39)	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	130,682,915 (GRCm39)	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	130,676,149 (GRCm39)	intron	probably benign
IGL02160:Dmbt1	APN	7	130,684,418 (GRCm39)	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	130,694,986 (GRCm39)	splice site	probably benign
IGL02197:Dmbt1	APN	7	130,687,152 (GRCm39)	splice site	probably benign
IGL02332:Dmbt1	APN	7	130,668,343 (GRCm39)	intron	probably benign
IGL02427:Dmbt1	APN	7	130,689,815 (GRCm39)	splice site	probably null
IGL02726:Dmbt1	APN	7	130,676,140 (GRCm39)	intron	probably benign
IGL02967:Dmbt1	APN	7	130,672,919 (GRCm39)	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	130,684,409 (GRCm39)	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	130,712,778 (GRCm39)	missense	probably damaging	0.99
cavity	UTSW	7	130,713,965 (GRCm39)	missense	unknown
lacunar	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
BB005:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
BB015:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
H8562:Dmbt1	UTSW	7	130,713,805 (GRCm39)	nonsense	probably null
K3955:Dmbt1	UTSW	7	130,721,293 (GRCm39)	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	130,708,123 (GRCm39)	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	130,697,779 (GRCm39)	splice site	probably benign
R0427:Dmbt1	UTSW	7	130,642,632 (GRCm39)	nonsense	probably null
R0478:Dmbt1	UTSW	7	130,642,917 (GRCm39)	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	130,699,403 (GRCm39)	splice site	probably null
R0538:Dmbt1	UTSW	7	130,651,631 (GRCm39)	splice site	probably benign
R0626:Dmbt1	UTSW	7	130,703,811 (GRCm39)	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	130,699,383 (GRCm39)	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	130,694,847 (GRCm39)	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	130,676,254 (GRCm39)	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	130,651,944 (GRCm39)	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	130,646,217 (GRCm39)	splice site	probably benign
R1463:Dmbt1	UTSW	7	130,711,366 (GRCm39)	critical splice donor site	probably null
R1509:Dmbt1	UTSW	7	130,676,061 (GRCm39)	intron	probably benign
R1990:Dmbt1	UTSW	7	130,660,018 (GRCm39)	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	130,708,089 (GRCm39)	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	130,700,863 (GRCm39)	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	130,651,748 (GRCm39)	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	130,703,762 (GRCm39)	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	130,699,305 (GRCm39)	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	130,648,292 (GRCm39)	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	130,692,224 (GRCm39)	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	130,708,198 (GRCm39)	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	130,696,464 (GRCm39)	nonsense	probably null
R3014:Dmbt1	UTSW	7	130,633,827 (GRCm39)	intron	probably benign
R3155:Dmbt1	UTSW	7	130,651,887 (GRCm39)	nonsense	probably null
R3176:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3276:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	130,707,979 (GRCm39)	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	130,713,819 (GRCm39)	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	130,675,932 (GRCm39)	intron	probably benign
R4396:Dmbt1	UTSW	7	130,718,361 (GRCm39)	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	130,642,664 (GRCm39)	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	130,651,742 (GRCm39)	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	130,696,472 (GRCm39)	missense	probably benign	0.01
R5156:Dmbt1	UTSW	7	130,699,400 (GRCm39)	critical splice donor site	probably null
R5225:Dmbt1	UTSW	7	130,696,465 (GRCm39)	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	130,684,349 (GRCm39)	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	130,642,751 (GRCm39)	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	130,721,240 (GRCm39)	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	130,642,723 (GRCm39)	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	130,665,133 (GRCm39)	intron	probably benign
R5526:Dmbt1	UTSW	7	130,642,920 (GRCm39)	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	130,701,030 (GRCm39)	nonsense	probably null
R5566:Dmbt1	UTSW	7	130,708,003 (GRCm39)	missense	probably damaging	1.00
R5595:Dmbt1	UTSW	7	130,655,797 (GRCm39)	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	130,711,370 (GRCm39)	splice site	probably null
R6188:Dmbt1	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6215:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	130,705,308 (GRCm39)	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	130,718,370 (GRCm39)	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	130,648,240 (GRCm39)	splice site	probably null
R6719:Dmbt1	UTSW	7	130,721,332 (GRCm39)	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	130,648,291 (GRCm39)	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	130,668,464 (GRCm39)	nonsense	probably null
R7191:Dmbt1	UTSW	7	130,646,250 (GRCm39)	missense	unknown
R7269:Dmbt1	UTSW	7	130,668,351 (GRCm39)	missense	unknown
R7288:Dmbt1	UTSW	7	130,685,519 (GRCm39)	nonsense	probably null
R7296:Dmbt1	UTSW	7	130,713,861 (GRCm39)	missense	unknown
R7349:Dmbt1	UTSW	7	130,642,854 (GRCm39)	missense	unknown
R7386:Dmbt1	UTSW	7	130,713,965 (GRCm39)	missense	unknown
R7428:Dmbt1	UTSW	7	130,710,192 (GRCm39)	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	130,681,241 (GRCm39)	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	130,668,192 (GRCm39)	missense	unknown
R7553:Dmbt1	UTSW	7	130,706,597 (GRCm39)	missense	unknown
R7567:Dmbt1	UTSW	7	130,663,093 (GRCm39)	splice site	probably null
R7584:Dmbt1	UTSW	7	130,690,481 (GRCm39)	nonsense	probably null
R7736:Dmbt1	UTSW	7	130,718,625 (GRCm39)	missense	unknown
R7758:Dmbt1	UTSW	7	130,722,926 (GRCm39)	missense	unknown
R7928:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
R8080:Dmbt1	UTSW	7	130,690,500 (GRCm39)	missense	unknown
R8098:Dmbt1	UTSW	7	130,710,188 (GRCm39)	nonsense	probably null
R8125:Dmbt1	UTSW	7	130,700,953 (GRCm39)	missense	unknown
R8177:Dmbt1	UTSW	7	130,708,162 (GRCm39)	missense	possibly damaging	0.46
R8350:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8366:Dmbt1	UTSW	7	130,668,330 (GRCm39)	missense	unknown
R8378:Dmbt1	UTSW	7	130,708,195 (GRCm39)	missense	probably damaging	0.96
R8399:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8400:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8445:Dmbt1	UTSW	7	130,692,110 (GRCm39)	missense	unknown
R8450:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8511:Dmbt1	UTSW	7	130,703,742 (GRCm39)	missense	unknown
R8688:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	unknown
R8850:Dmbt1	UTSW	7	130,692,134 (GRCm39)	missense	unknown
R8852:Dmbt1	UTSW	7	130,642,853 (GRCm39)	missense	unknown
R8871:Dmbt1	UTSW	7	130,718,597 (GRCm39)	missense	unknown
R8943:Dmbt1	UTSW	7	130,721,372 (GRCm39)	missense	possibly damaging	0.68
R8978:Dmbt1	UTSW	7	130,639,611 (GRCm39)	missense	possibly damaging	0.53
R9004:Dmbt1	UTSW	7	130,713,798 (GRCm39)	missense	unknown
R9020:Dmbt1	UTSW	7	130,712,787 (GRCm39)	missense	possibly damaging	0.86
R9088:Dmbt1	UTSW	7	130,718,418 (GRCm39)	missense	unknown
R9230:Dmbt1	UTSW	7	130,639,642 (GRCm39)	missense	probably benign	0.01
R9304:Dmbt1	UTSW	7	130,700,855 (GRCm39)	missense	unknown
R9377:Dmbt1	UTSW	7	130,694,832 (GRCm39)	missense	unknown
R9428:Dmbt1	UTSW	7	130,668,208 (GRCm39)	missense	unknown
R9474:Dmbt1	UTSW	7	130,675,987 (GRCm39)	missense	unknown
R9573:Dmbt1	UTSW	7	130,657,910 (GRCm39)	critical splice donor site	probably null
R9675:Dmbt1	UTSW	7	130,712,652 (GRCm39)	missense	probably damaging	0.98
R9689:Dmbt1	UTSW	7	130,660,015 (GRCm39)	missense	unknown
R9781:Dmbt1	UTSW	7	130,639,599 (GRCm39)	missense	probably benign	0.00
X0024:Dmbt1	UTSW	7	130,713,977 (GRCm39)	nonsense	probably null
X0062:Dmbt1	UTSW	7	130,696,581 (GRCm39)	missense	possibly damaging	0.81
Z1176:Dmbt1	UTSW	7	130,690,542 (GRCm39)	missense	unknown
Z1177:Dmbt1	UTSW	7	130,684,215 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGAAGGAGGCTGCAACTATG -3'
(R):5'- TGTACATCCCATCAGTCAGTGC -3'

Sequencing Primer
(F):5'- GGAGGCTGCAACTATGACTATATCC -3'
(R):5'- CATCAGTCAGTGCTGGCCAAAG -3'

Posted On

2019-10-17