Incidental Mutation 'R7513:Timeless'
ID582234
Institutional Source Beutler Lab
Gene Symbol Timeless
Ensembl Gene ENSMUSG00000039994
Gene Nametimeless circadian clock 1
Synonymstim
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7513 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128232065-128252941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128249530 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 839 (V839A)
Ref Sequence ENSEMBL: ENSMUSP00000058021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000060782] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245] [ENSMUST00000218722]
Predicted Effect probably damaging
Transcript: ENSMUST00000055539
AA Change: V839A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994
AA Change: V839A

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060782
SMART Domains Protein: ENSMUSP00000059142
Gene: ENSMUSG00000051716

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipo_F 50 247 2.1e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105242
AA Change: V839A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994
AA Change: V839A

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105243
SMART Domains Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 7.8e-104 PFAM
low complexity region 381 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105244
AA Change: V839A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994
AA Change: V839A

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105245
AA Change: V839A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994
AA Change: V839A

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218722
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,272,071 G1709R unknown Het
Abcb1a G A 5: 8,715,771 W694* probably null Het
Accs T C 2: 93,840,092 N256S possibly damaging Het
Agmo C T 12: 37,244,353 T100I probably benign Het
Alox8 T C 11: 69,187,844 D341G probably benign Het
Apol7c T A 15: 77,525,711 E345V possibly damaging Het
Arl5a A G 2: 52,412,145 F86L possibly damaging Het
AU040320 A G 4: 126,792,264 E211G probably benign Het
B020011L13Rik T A 1: 117,801,419 C219S probably damaging Het
Btaf1 T A 19: 36,978,403 L579Q probably benign Het
Cd84 T A 1: 171,884,618 V267E probably benign Het
Clec11a T C 7: 44,306,356 E89G probably benign Het
Csrnp2 C A 15: 100,482,416 E331D probably benign Het
Cyp2d12 C A 15: 82,558,420 H355N probably benign Het
D3Ertd254e T A 3: 36,164,643 F272I possibly damaging Het
Ddx24 C A 12: 103,419,106 G413* probably null Het
Dhx38 G A 8: 109,560,589 P249L probably benign Het
Dip2a A T 10: 76,313,235 M233K probably benign Het
Dip2b T A 15: 100,207,748 probably null Het
Dmbt1 T C 7: 131,090,512 S1003P unknown Het
Dna2 A G 10: 62,971,968 D1033G probably benign Het
Dnah5 T C 15: 28,370,415 S2834P probably benign Het
Dnah7b T G 1: 46,124,346 S437A probably benign Het
Eif5 A T 12: 111,540,252 I93F probably damaging Het
Fbxo47 A G 11: 97,856,229 F337S probably damaging Het
Gm8765 T A 13: 50,702,873 I849N probably benign Het
Helz T C 11: 107,656,115 I1086T probably damaging Het
Ifi208 A T 1: 173,695,654 R497* probably null Het
Igfn1 T G 1: 135,959,967 D2453A probably damaging Het
Ighg2c A T 12: 113,288,851 L27Q Het
Jak1 C T 4: 101,191,651 C10Y probably damaging Het
Kif7 T A 7: 79,711,028 N200Y possibly damaging Het
Ktn1 G C 14: 47,664,084 A100P possibly damaging Het
Lrsam1 T C 2: 32,953,485 D136G probably benign Het
Man2c1 T C 9: 57,139,399 L648P probably benign Het
Mki67 T C 7: 135,693,223 I3116V probably benign Het
Mmp10 A T 9: 7,508,127 D418V probably damaging Het
Mrpl24 A T 3: 87,922,427 T107S probably benign Het
Mycbpap T A 11: 94,503,556 D296V probably damaging Het
Mycn C A 12: 12,939,742 A218S probably benign Het
Myo1f G T 17: 33,575,814 W9C probably damaging Het
Nckap1 T A 2: 80,502,291 K1074N possibly damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nhsl1 T C 10: 18,523,952 S275P probably damaging Het
Olfr180 T A 16: 58,915,932 K236N probably damaging Het
Olfr709-ps1 A G 7: 106,927,276 F61S possibly damaging Het
Pam G A 1: 97,853,185 P514S possibly damaging Het
Pcdha4 C T 18: 36,953,339 L192F probably damaging Het
Per1 T A 11: 69,105,571 D800E probably benign Het
Plcg2 C A 8: 117,579,853 N315K probably damaging Het
Plxnb2 T A 15: 89,158,322 probably null Het
Pnpla1 A G 17: 28,858,807 probably benign Het
Pptc7 A T 5: 122,308,129 probably null Het
Psg26 G T 7: 18,475,300 S394R probably benign Het
Psmc1 C A 12: 100,115,514 T125K probably benign Het
Ptgis T A 2: 167,225,283 M125L probably benign Het
Rbms1 A G 2: 60,758,821 Y323H probably damaging Het
Rgl2 G A 17: 33,932,555 R191Q probably benign Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Sirpb1b C A 3: 15,542,140 E361* probably null Het
Slc13a4 A T 6: 35,283,337 probably null Het
Spag9 T C 11: 94,112,083 S1140P probably damaging Het
Tas2r137 A G 6: 40,492,150 N305D probably damaging Het
Tenm2 G A 11: 36,051,900 A1314V probably benign Het
Tgm3 A G 2: 130,024,404 T81A probably benign Het
Tmem132a A G 19: 10,860,128 I606T probably damaging Het
Tox T A 4: 6,741,507 M158L probably benign Het
Trpc2 A T 7: 102,090,068 M549L probably damaging Het
Trpm5 C T 7: 143,081,835 R600Q possibly damaging Het
Trpv1 A G 11: 73,240,541 N302D probably damaging Het
Ttn C T 2: 76,851,596 R1019H Het
Ttn G T 2: 76,944,963 H1958N unknown Het
Usp32 A T 11: 85,027,112 Y769* probably null Het
Vim A T 2: 13,578,632 Q255L possibly damaging Het
Vmn1r84 T C 7: 12,362,067 H233R probably benign Het
Xirp2 T A 2: 67,510,764 H1116Q possibly damaging Het
Zc3h18 G T 8: 122,408,254 R580L unknown Het
Zfp442 A T 2: 150,408,756 C409S unknown Het
Zfy1 A T Y: 759,852 I20K unknown Het
Other mutations in Timeless
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Timeless APN 10 128241708 missense probably damaging 1.00
IGL02157:Timeless APN 10 128242386 missense probably benign 0.01
IGL02300:Timeless APN 10 128244807 missense probably benign 0.00
IGL02587:Timeless APN 10 128239916 missense probably damaging 0.99
IGL02588:Timeless APN 10 128243334 missense probably damaging 1.00
IGL02892:Timeless APN 10 128244251 missense probably damaging 1.00
IGL02930:Timeless APN 10 128247191 missense probably benign 0.00
IGL02986:Timeless APN 10 128249760 missense possibly damaging 0.82
IGL03345:Timeless APN 10 128247586 missense probably benign 0.04
IGL03393:Timeless APN 10 128252055 missense probably damaging 1.00
R0388:Timeless UTSW 10 128241425 splice site probably null
R0607:Timeless UTSW 10 128246334 missense probably benign
R0638:Timeless UTSW 10 128244673 nonsense probably null
R0734:Timeless UTSW 10 128250060 missense probably damaging 1.00
R1346:Timeless UTSW 10 128242365 missense possibly damaging 0.83
R1625:Timeless UTSW 10 128240624 missense probably damaging 0.99
R1771:Timeless UTSW 10 128247608 missense probably benign 0.11
R1860:Timeless UTSW 10 128246114 missense probably benign 0.00
R1920:Timeless UTSW 10 128241714 missense probably damaging 1.00
R1988:Timeless UTSW 10 128244187 missense probably damaging 0.98
R2981:Timeless UTSW 10 128248458 missense probably benign 0.34
R4359:Timeless UTSW 10 128247342 missense probably benign 0.00
R4647:Timeless UTSW 10 128239956 missense possibly damaging 0.80
R4753:Timeless UTSW 10 128240020 utr 5 prime probably benign
R4868:Timeless UTSW 10 128247361 missense probably benign
R4901:Timeless UTSW 10 128250762 missense probably damaging 1.00
R4956:Timeless UTSW 10 128241651 missense probably damaging 1.00
R5341:Timeless UTSW 10 128247178 missense possibly damaging 0.81
R5439:Timeless UTSW 10 128241735 missense probably damaging 1.00
R5585:Timeless UTSW 10 128240243 missense probably damaging 0.97
R5842:Timeless UTSW 10 128247459 critical splice donor site probably null
R5843:Timeless UTSW 10 128244244 splice site probably null
R6005:Timeless UTSW 10 128244200 missense probably damaging 0.99
R6271:Timeless UTSW 10 128250724 missense probably damaging 1.00
R6558:Timeless UTSW 10 128249563 missense probably benign 0.01
R6694:Timeless UTSW 10 128239999 critical splice donor site probably null
R6738:Timeless UTSW 10 128240635 missense probably damaging 1.00
R6760:Timeless UTSW 10 128246117 missense probably benign 0.38
R7213:Timeless UTSW 10 128243289 missense probably benign
R7248:Timeless UTSW 10 128252001 missense probably benign
R7345:Timeless UTSW 10 128249754 missense probably damaging 1.00
R7463:Timeless UTSW 10 128250426 missense probably benign 0.00
R7574:Timeless UTSW 10 128244669 missense probably damaging 1.00
R8220:Timeless UTSW 10 128246396 missense probably damaging 0.98
R8418:Timeless UTSW 10 128250736 missense probably benign 0.02
X0028:Timeless UTSW 10 128250325 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTCAGGTCTTCCAGCCACAG -3'
(R):5'- GACAATCTGGGTCCCTTTCC -3'

Sequencing Primer
(F):5'- GTCTTCCAGCCACAGAGCTC -3'
(R):5'- TTCCTATTCAGCCAGGGGTCAG -3'
Posted On2019-10-17