Incidental Mutation 'R7513:Trpv1'
ID582238
Institutional Source Beutler Lab
Gene Symbol Trpv1
Ensembl Gene ENSMUSG00000005952
Gene Nametransient receptor potential cation channel, subfamily V, member 1
SynonymsOTRPC1, VR-1, capsaicin receptor, Vr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R7513 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73234292-73261242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73240541 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 302 (N302D)
Ref Sequence ENSEMBL: ENSMUSP00000099585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006106] [ENSMUST00000102526] [ENSMUST00000108470] [ENSMUST00000138853]
Predicted Effect probably damaging
Transcript: ENSMUST00000006106
AA Change: N302D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006106
Gene: ENSMUSG00000005952
AA Change: N302D

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 4e-8 BLAST
Blast:ANK 334 370 6e-9 BLAST
PDB:3J5R|D 339 660 N/A PDB
Blast:PHB 658 704 1e-8 BLAST
PDB:3SUI|B 708 742 1e-15 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000102526
AA Change: N302D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099585
Gene: ENSMUSG00000005952
AA Change: N302D

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 5e-8 BLAST
ANK 333 363 6.17e-1 SMART
Pfam:Ion_trans 432 695 3e-12 PFAM
Blast:PHB 718 764 1e-8 BLAST
PDB:3SUI|B 768 802 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108470
SMART Domains Protein: ENSMUSP00000104110
Gene: ENSMUSG00000005952

DomainStartEndE-ValueType
Blast:ANK 26 62 4e-9 BLAST
Pfam:Ion_trans 111 315 1.8e-8 PFAM
Blast:PHB 350 396 6e-9 BLAST
PDB:3SUI|B 400 434 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138853
SMART Domains Protein: ENSMUSP00000116400
Gene: ENSMUSG00000005952

DomainStartEndE-ValueType
ANK 25 55 6.17e-1 SMART
Pfam:Ion_trans 171 375 1.8e-8 PFAM
Blast:PHB 410 456 6e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Capsaicin, the main pungent ingredient in hot chili peppers, elicits a sensation of burning pain by selectively activating sensory neurons that convey information about noxious stimuli to the central nervous system. The protein encoded by this gene is a receptor for capsaicin and is a non-selective cation channel that is structurally related to members of the TRP family of ion channels. This receptor is also activated by increases in temperature in the noxious range, suggesting that it functions as a transducer of painful thermal stimuli in vivo. Four transcript variants encoding the same protein, but with different 5' UTR sequence, have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal nociception, abnormal anxiety- and conditioning-related behaviors, increased sensitivity to DOCA-salt-induced renal damage, resistance to diet-induced obesity, altered taste sensitivity, and impaired febrile response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,272,071 G1709R unknown Het
Abcb1a G A 5: 8,715,771 W694* probably null Het
Accs T C 2: 93,840,092 N256S possibly damaging Het
Agmo C T 12: 37,244,353 T100I probably benign Het
Alox8 T C 11: 69,187,844 D341G probably benign Het
Apol7c T A 15: 77,525,711 E345V possibly damaging Het
Arl5a A G 2: 52,412,145 F86L possibly damaging Het
AU040320 A G 4: 126,792,264 E211G probably benign Het
B020011L13Rik T A 1: 117,801,419 C219S probably damaging Het
Btaf1 T A 19: 36,978,403 L579Q probably benign Het
Cd84 T A 1: 171,884,618 V267E probably benign Het
Clec11a T C 7: 44,306,356 E89G probably benign Het
Csrnp2 C A 15: 100,482,416 E331D probably benign Het
Cyp2d12 C A 15: 82,558,420 H355N probably benign Het
D3Ertd254e T A 3: 36,164,643 F272I possibly damaging Het
Ddx24 C A 12: 103,419,106 G413* probably null Het
Dhx38 G A 8: 109,560,589 P249L probably benign Het
Dip2a A T 10: 76,313,235 M233K probably benign Het
Dip2b T A 15: 100,207,748 probably null Het
Dmbt1 T C 7: 131,090,512 S1003P unknown Het
Dna2 A G 10: 62,971,968 D1033G probably benign Het
Dnah5 T C 15: 28,370,415 S2834P probably benign Het
Dnah7b T G 1: 46,124,346 S437A probably benign Het
Eif5 A T 12: 111,540,252 I93F probably damaging Het
Fbxo47 A G 11: 97,856,229 F337S probably damaging Het
Gm8765 T A 13: 50,702,873 I849N probably benign Het
Helz T C 11: 107,656,115 I1086T probably damaging Het
Ifi208 A T 1: 173,695,654 R497* probably null Het
Igfn1 T G 1: 135,959,967 D2453A probably damaging Het
Ighg2c A T 12: 113,288,851 L27Q Het
Jak1 C T 4: 101,191,651 C10Y probably damaging Het
Kif7 T A 7: 79,711,028 N200Y possibly damaging Het
Ktn1 G C 14: 47,664,084 A100P possibly damaging Het
Lrsam1 T C 2: 32,953,485 D136G probably benign Het
Man2c1 T C 9: 57,139,399 L648P probably benign Het
Mki67 T C 7: 135,693,223 I3116V probably benign Het
Mmp10 A T 9: 7,508,127 D418V probably damaging Het
Mrpl24 A T 3: 87,922,427 T107S probably benign Het
Mycbpap T A 11: 94,503,556 D296V probably damaging Het
Mycn C A 12: 12,939,742 A218S probably benign Het
Myo1f G T 17: 33,575,814 W9C probably damaging Het
Nckap1 T A 2: 80,502,291 K1074N possibly damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nhsl1 T C 10: 18,523,952 S275P probably damaging Het
Olfr180 T A 16: 58,915,932 K236N probably damaging Het
Olfr709-ps1 A G 7: 106,927,276 F61S possibly damaging Het
Pam G A 1: 97,853,185 P514S possibly damaging Het
Pcdha4 C T 18: 36,953,339 L192F probably damaging Het
Per1 T A 11: 69,105,571 D800E probably benign Het
Plcg2 C A 8: 117,579,853 N315K probably damaging Het
Plxnb2 T A 15: 89,158,322 probably null Het
Pnpla1 A G 17: 28,858,807 probably benign Het
Pptc7 A T 5: 122,308,129 probably null Het
Psg26 G T 7: 18,475,300 S394R probably benign Het
Psmc1 C A 12: 100,115,514 T125K probably benign Het
Ptgis T A 2: 167,225,283 M125L probably benign Het
Rbms1 A G 2: 60,758,821 Y323H probably damaging Het
Rgl2 G A 17: 33,932,555 R191Q probably benign Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Sirpb1b C A 3: 15,542,140 E361* probably null Het
Slc13a4 A T 6: 35,283,337 probably null Het
Spag9 T C 11: 94,112,083 S1140P probably damaging Het
Tas2r137 A G 6: 40,492,150 N305D probably damaging Het
Tenm2 G A 11: 36,051,900 A1314V probably benign Het
Tgm3 A G 2: 130,024,404 T81A probably benign Het
Timeless T C 10: 128,249,530 V839A probably damaging Het
Tmem132a A G 19: 10,860,128 I606T probably damaging Het
Tox T A 4: 6,741,507 M158L probably benign Het
Trpc2 A T 7: 102,090,068 M549L probably damaging Het
Trpm5 C T 7: 143,081,835 R600Q possibly damaging Het
Ttn G T 2: 76,944,963 H1958N unknown Het
Ttn C T 2: 76,851,596 R1019H Het
Usp32 A T 11: 85,027,112 Y769* probably null Het
Vim A T 2: 13,578,632 Q255L possibly damaging Het
Vmn1r84 T C 7: 12,362,067 H233R probably benign Het
Xirp2 T A 2: 67,510,764 H1116Q possibly damaging Het
Zc3h18 G T 8: 122,408,254 R580L unknown Het
Zfp442 A T 2: 150,408,756 C409S unknown Het
Zfy1 A T Y: 759,852 I20K unknown Het
Other mutations in Trpv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Trpv1 APN 11 73260362 missense probably damaging 0.99
IGL01348:Trpv1 APN 11 73238252 unclassified probably null
IGL01568:Trpv1 APN 11 73238443 missense probably benign 0.01
IGL01638:Trpv1 APN 11 73253329 missense probably damaging 0.98
IGL02092:Trpv1 APN 11 73246079 splice site probably benign
IGL02167:Trpv1 APN 11 73254797 missense probably damaging 1.00
IGL02649:Trpv1 APN 11 73250786 missense probably damaging 1.00
IGL03396:Trpv1 APN 11 73253056 missense probably benign 0.01
IGL03402:Trpv1 APN 11 73239637 missense possibly damaging 0.73
R0112:Trpv1 UTSW 11 73253272 missense probably damaging 1.00
R0433:Trpv1 UTSW 11 73253008 splice site probably benign
R0482:Trpv1 UTSW 11 73239429 missense probably damaging 1.00
R0494:Trpv1 UTSW 11 73260442 missense probably benign
R1401:Trpv1 UTSW 11 73240126 splice site probably null
R2032:Trpv1 UTSW 11 73238385 missense probably benign
R2199:Trpv1 UTSW 11 73240251 missense probably damaging 0.96
R2263:Trpv1 UTSW 11 73241682 missense probably damaging 1.00
R2939:Trpv1 UTSW 11 73254849 missense probably damaging 0.99
R2940:Trpv1 UTSW 11 73254849 missense probably damaging 0.99
R3743:Trpv1 UTSW 11 73254302 missense probably damaging 1.00
R3805:Trpv1 UTSW 11 73253053 missense probably damaging 0.99
R4073:Trpv1 UTSW 11 73250780 missense probably damaging 0.96
R4294:Trpv1 UTSW 11 73240464 missense probably damaging 1.00
R4650:Trpv1 UTSW 11 73238263 missense probably benign 0.04
R4700:Trpv1 UTSW 11 73251284 missense possibly damaging 0.47
R5114:Trpv1 UTSW 11 73241748 missense probably damaging 1.00
R5153:Trpv1 UTSW 11 73238516 missense probably benign 0.32
R5319:Trpv1 UTSW 11 73239589 missense probably damaging 0.99
R5516:Trpv1 UTSW 11 73245983 missense probably benign 0.44
R5845:Trpv1 UTSW 11 73240581 missense probably damaging 1.00
R6134:Trpv1 UTSW 11 73244317 missense probably benign 0.01
R6232:Trpv1 UTSW 11 73250810 missense possibly damaging 0.88
R6383:Trpv1 UTSW 11 73246036 missense probably damaging 1.00
R7200:Trpv1 UTSW 11 73239586 missense probably damaging 1.00
R7319:Trpv1 UTSW 11 73250794 missense probably benign 0.01
R7323:Trpv1 UTSW 11 73260337 missense possibly damaging 0.82
R7361:Trpv1 UTSW 11 73260377 missense probably damaging 0.99
R7373:Trpv1 UTSW 11 73240673 missense probably damaging 1.00
R7444:Trpv1 UTSW 11 73244204 missense possibly damaging 0.89
R7488:Trpv1 UTSW 11 73238529 missense probably benign 0.00
R7762:Trpv1 UTSW 11 73254222 missense probably benign 0.01
X0067:Trpv1 UTSW 11 73244201 critical splice acceptor site probably null
Z1176:Trpv1 UTSW 11 73240188 missense probably damaging 1.00
Z1176:Trpv1 UTSW 11 73240507 missense probably damaging 1.00
Z1177:Trpv1 UTSW 11 73254773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGACTAGCCTCATTGGTG -3'
(R):5'- TTAGAGTCCTCTACACACAGCC -3'

Sequencing Primer
(F):5'- ACTGGGGATCCTGTGTTCGC -3'
(R):5'- CTGCCTGGTGTCCACAG -3'
Posted On2019-10-17