Incidental Mutation 'R7513:Helz'
ID582243
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7513 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107656115 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1086 (I1086T)
Ref Sequence ENSEMBL: ENSMUSP00000074533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
Predicted Effect probably damaging
Transcript: ENSMUST00000075012
AA Change: I1086T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: I1086T

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100305
AA Change: I1085T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: I1085T

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106746
AA Change: I1085T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: I1085T

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133862
AA Change: I404T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721
AA Change: I404T

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,272,071 G1709R unknown Het
Abcb1a G A 5: 8,715,771 W694* probably null Het
Accs T C 2: 93,840,092 N256S possibly damaging Het
Agmo C T 12: 37,244,353 T100I probably benign Het
Alox8 T C 11: 69,187,844 D341G probably benign Het
Apol7c T A 15: 77,525,711 E345V possibly damaging Het
Arl5a A G 2: 52,412,145 F86L possibly damaging Het
AU040320 A G 4: 126,792,264 E211G probably benign Het
B020011L13Rik T A 1: 117,801,419 C219S probably damaging Het
Btaf1 T A 19: 36,978,403 L579Q probably benign Het
Cd84 T A 1: 171,884,618 V267E probably benign Het
Clec11a T C 7: 44,306,356 E89G probably benign Het
Csrnp2 C A 15: 100,482,416 E331D probably benign Het
Cyp2d12 C A 15: 82,558,420 H355N probably benign Het
D3Ertd254e T A 3: 36,164,643 F272I possibly damaging Het
Ddx24 C A 12: 103,419,106 G413* probably null Het
Dhx38 G A 8: 109,560,589 P249L probably benign Het
Dip2a A T 10: 76,313,235 M233K probably benign Het
Dip2b T A 15: 100,207,748 probably null Het
Dmbt1 T C 7: 131,090,512 S1003P unknown Het
Dna2 A G 10: 62,971,968 D1033G probably benign Het
Dnah5 T C 15: 28,370,415 S2834P probably benign Het
Dnah7b T G 1: 46,124,346 S437A probably benign Het
Eif5 A T 12: 111,540,252 I93F probably damaging Het
Fbxo47 A G 11: 97,856,229 F337S probably damaging Het
Gm8765 T A 13: 50,702,873 I849N probably benign Het
Ifi208 A T 1: 173,695,654 R497* probably null Het
Igfn1 T G 1: 135,959,967 D2453A probably damaging Het
Ighg2c A T 12: 113,288,851 L27Q Het
Jak1 C T 4: 101,191,651 C10Y probably damaging Het
Kif7 T A 7: 79,711,028 N200Y possibly damaging Het
Ktn1 G C 14: 47,664,084 A100P possibly damaging Het
Lrsam1 T C 2: 32,953,485 D136G probably benign Het
Man2c1 T C 9: 57,139,399 L648P probably benign Het
Mki67 T C 7: 135,693,223 I3116V probably benign Het
Mmp10 A T 9: 7,508,127 D418V probably damaging Het
Mrpl24 A T 3: 87,922,427 T107S probably benign Het
Mycbpap T A 11: 94,503,556 D296V probably damaging Het
Mycn C A 12: 12,939,742 A218S probably benign Het
Myo1f G T 17: 33,575,814 W9C probably damaging Het
Nckap1 T A 2: 80,502,291 K1074N possibly damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nhsl1 T C 10: 18,523,952 S275P probably damaging Het
Olfr180 T A 16: 58,915,932 K236N probably damaging Het
Olfr709-ps1 A G 7: 106,927,276 F61S possibly damaging Het
Pam G A 1: 97,853,185 P514S possibly damaging Het
Pcdha4 C T 18: 36,953,339 L192F probably damaging Het
Per1 T A 11: 69,105,571 D800E probably benign Het
Plcg2 C A 8: 117,579,853 N315K probably damaging Het
Plxnb2 T A 15: 89,158,322 probably null Het
Pnpla1 A G 17: 28,858,807 probably benign Het
Pptc7 A T 5: 122,308,129 probably null Het
Psg26 G T 7: 18,475,300 S394R probably benign Het
Psmc1 C A 12: 100,115,514 T125K probably benign Het
Ptgis T A 2: 167,225,283 M125L probably benign Het
Rbms1 A G 2: 60,758,821 Y323H probably damaging Het
Rgl2 G A 17: 33,932,555 R191Q probably benign Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Sirpb1b C A 3: 15,542,140 E361* probably null Het
Slc13a4 A T 6: 35,283,337 probably null Het
Spag9 T C 11: 94,112,083 S1140P probably damaging Het
Tas2r137 A G 6: 40,492,150 N305D probably damaging Het
Tenm2 G A 11: 36,051,900 A1314V probably benign Het
Tgm3 A G 2: 130,024,404 T81A probably benign Het
Timeless T C 10: 128,249,530 V839A probably damaging Het
Tmem132a A G 19: 10,860,128 I606T probably damaging Het
Tox T A 4: 6,741,507 M158L probably benign Het
Trpc2 A T 7: 102,090,068 M549L probably damaging Het
Trpm5 C T 7: 143,081,835 R600Q possibly damaging Het
Trpv1 A G 11: 73,240,541 N302D probably damaging Het
Ttn C T 2: 76,851,596 R1019H Het
Ttn G T 2: 76,944,963 H1958N unknown Het
Usp32 A T 11: 85,027,112 Y769* probably null Het
Vim A T 2: 13,578,632 Q255L possibly damaging Het
Vmn1r84 T C 7: 12,362,067 H233R probably benign Het
Xirp2 T A 2: 67,510,764 H1116Q possibly damaging Het
Zc3h18 G T 8: 122,408,254 R580L unknown Het
Zfp442 A T 2: 150,408,756 C409S unknown Het
Zfy1 A T Y: 759,852 I20K unknown Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R8024:Helz UTSW 11 107686421 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- GTATCCAACGTGGGGCAGTG -3'
(R):5'- TCTCAGCAAAGTTCCTTGCAAATAC -3'

Sequencing Primer
(F):5'- GCAGTGGGCAGAATTTGAACTTATC -3'
(R):5'- TTGCAAATACAGCTGTGGCC -3'
Posted On2019-10-17