Incidental Mutation 'R7513:Ddx24'
ID582247
Institutional Source Beutler Lab
Gene Symbol Ddx24
Ensembl Gene ENSMUSG00000041645
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Synonyms2510027P10Rik, 1700055J08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7513 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location103407982-103425830 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 103419106 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 413 (G413*)
Ref Sequence ENSEMBL: ENSMUSP00000105628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044923] [ENSMUST00000110001] [ENSMUST00000221211]
Predicted Effect probably null
Transcript: ENSMUST00000044923
AA Change: G367*
SMART Domains Protein: ENSMUSP00000040890
Gene: ENSMUSG00000041645
AA Change: G367*

DomainStartEndE-ValueType
low complexity region 94 101 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 168 180 N/A INTRINSIC
DEXDc 212 541 1.14e-39 SMART
HELICc 601 682 5.22e-25 SMART
low complexity region 752 766 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110001
AA Change: G413*
SMART Domains Protein: ENSMUSP00000105628
Gene: ENSMUSG00000041645
AA Change: G413*

DomainStartEndE-ValueType
low complexity region 140 147 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
low complexity region 214 226 N/A INTRINSIC
DEXDc 258 587 1.14e-39 SMART
HELICc 647 728 5.22e-25 SMART
low complexity region 798 812 N/A INTRINSIC
low complexity region 821 833 N/A INTRINSIC
low complexity region 881 898 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000221211
AA Change: G367*
Predicted Effect probably benign
Transcript: ENSMUST00000222782
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which shows little similarity to any of the other known human DEAD box proteins, but shows a high similarity to mouse Ddx24 at the amino acid level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is embryonic lethal: embryos die between implantation and placentation. Heterozygous KO animals are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,272,071 G1709R unknown Het
Abcb1a G A 5: 8,715,771 W694* probably null Het
Accs T C 2: 93,840,092 N256S possibly damaging Het
Agmo C T 12: 37,244,353 T100I probably benign Het
Alox8 T C 11: 69,187,844 D341G probably benign Het
Apol7c T A 15: 77,525,711 E345V possibly damaging Het
Arl5a A G 2: 52,412,145 F86L possibly damaging Het
AU040320 A G 4: 126,792,264 E211G probably benign Het
B020011L13Rik T A 1: 117,801,419 C219S probably damaging Het
Btaf1 T A 19: 36,978,403 L579Q probably benign Het
Cd84 T A 1: 171,884,618 V267E probably benign Het
Clec11a T C 7: 44,306,356 E89G probably benign Het
Csrnp2 C A 15: 100,482,416 E331D probably benign Het
Cyp2d12 C A 15: 82,558,420 H355N probably benign Het
D3Ertd254e T A 3: 36,164,643 F272I possibly damaging Het
Dhx38 G A 8: 109,560,589 P249L probably benign Het
Dip2a A T 10: 76,313,235 M233K probably benign Het
Dip2b T A 15: 100,207,748 probably null Het
Dmbt1 T C 7: 131,090,512 S1003P unknown Het
Dna2 A G 10: 62,971,968 D1033G probably benign Het
Dnah5 T C 15: 28,370,415 S2834P probably benign Het
Dnah7b T G 1: 46,124,346 S437A probably benign Het
Eif5 A T 12: 111,540,252 I93F probably damaging Het
Fbxo47 A G 11: 97,856,229 F337S probably damaging Het
Gm8765 T A 13: 50,702,873 I849N probably benign Het
Helz T C 11: 107,656,115 I1086T probably damaging Het
Ifi208 A T 1: 173,695,654 R497* probably null Het
Igfn1 T G 1: 135,959,967 D2453A probably damaging Het
Ighg2c A T 12: 113,288,851 L27Q Het
Jak1 C T 4: 101,191,651 C10Y probably damaging Het
Kif7 T A 7: 79,711,028 N200Y possibly damaging Het
Ktn1 G C 14: 47,664,084 A100P possibly damaging Het
Lrsam1 T C 2: 32,953,485 D136G probably benign Het
Man2c1 T C 9: 57,139,399 L648P probably benign Het
Mki67 T C 7: 135,693,223 I3116V probably benign Het
Mmp10 A T 9: 7,508,127 D418V probably damaging Het
Mrpl24 A T 3: 87,922,427 T107S probably benign Het
Mycbpap T A 11: 94,503,556 D296V probably damaging Het
Mycn C A 12: 12,939,742 A218S probably benign Het
Myo1f G T 17: 33,575,814 W9C probably damaging Het
Nckap1 T A 2: 80,502,291 K1074N possibly damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nhsl1 T C 10: 18,523,952 S275P probably damaging Het
Olfr180 T A 16: 58,915,932 K236N probably damaging Het
Olfr709-ps1 A G 7: 106,927,276 F61S possibly damaging Het
Pam G A 1: 97,853,185 P514S possibly damaging Het
Pcdha4 C T 18: 36,953,339 L192F probably damaging Het
Per1 T A 11: 69,105,571 D800E probably benign Het
Plcg2 C A 8: 117,579,853 N315K probably damaging Het
Plxnb2 T A 15: 89,158,322 probably null Het
Pnpla1 A G 17: 28,858,807 probably benign Het
Pptc7 A T 5: 122,308,129 probably null Het
Psg26 G T 7: 18,475,300 S394R probably benign Het
Psmc1 C A 12: 100,115,514 T125K probably benign Het
Ptgis T A 2: 167,225,283 M125L probably benign Het
Rbms1 A G 2: 60,758,821 Y323H probably damaging Het
Rgl2 G A 17: 33,932,555 R191Q probably benign Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Sirpb1b C A 3: 15,542,140 E361* probably null Het
Slc13a4 A T 6: 35,283,337 probably null Het
Spag9 T C 11: 94,112,083 S1140P probably damaging Het
Tas2r137 A G 6: 40,492,150 N305D probably damaging Het
Tenm2 G A 11: 36,051,900 A1314V probably benign Het
Tgm3 A G 2: 130,024,404 T81A probably benign Het
Timeless T C 10: 128,249,530 V839A probably damaging Het
Tmem132a A G 19: 10,860,128 I606T probably damaging Het
Tox T A 4: 6,741,507 M158L probably benign Het
Trpc2 A T 7: 102,090,068 M549L probably damaging Het
Trpm5 C T 7: 143,081,835 R600Q possibly damaging Het
Trpv1 A G 11: 73,240,541 N302D probably damaging Het
Ttn G T 2: 76,944,963 H1958N unknown Het
Ttn C T 2: 76,851,596 R1019H Het
Usp32 A T 11: 85,027,112 Y769* probably null Het
Vim A T 2: 13,578,632 Q255L possibly damaging Het
Vmn1r84 T C 7: 12,362,067 H233R probably benign Het
Xirp2 T A 2: 67,510,764 H1116Q possibly damaging Het
Zc3h18 G T 8: 122,408,254 R580L unknown Het
Zfp442 A T 2: 150,408,756 C409S unknown Het
Zfy1 A T Y: 759,852 I20K unknown Het
Other mutations in Ddx24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Ddx24 APN 12 103418202 missense probably damaging 0.97
IGL02102:Ddx24 APN 12 103408484 intron probably benign
IGL02225:Ddx24 APN 12 103417371 missense probably damaging 1.00
IGL02226:Ddx24 APN 12 103424458 missense possibly damaging 0.81
IGL02325:Ddx24 APN 12 103416266 missense probably damaging 1.00
IGL02568:Ddx24 APN 12 103417312 missense probably damaging 1.00
IGL02666:Ddx24 APN 12 103424055 missense possibly damaging 0.94
IGL02950:Ddx24 APN 12 103417542 missense probably damaging 1.00
IGL03244:Ddx24 APN 12 103417605 missense possibly damaging 0.53
P0028:Ddx24 UTSW 12 103408375 missense probably benign
R0195:Ddx24 UTSW 12 103418961 critical splice donor site probably null
R0540:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0607:Ddx24 UTSW 12 103419067 missense possibly damaging 0.92
R0621:Ddx24 UTSW 12 103425558 intron probably benign
R0964:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R1447:Ddx24 UTSW 12 103424307 missense possibly damaging 0.88
R1639:Ddx24 UTSW 12 103411319 critical splice acceptor site probably null
R1909:Ddx24 UTSW 12 103409982 missense probably damaging 0.99
R2418:Ddx24 UTSW 12 103417737 missense probably damaging 1.00
R3706:Ddx24 UTSW 12 103417416 missense probably damaging 1.00
R3725:Ddx24 UTSW 12 103417605 missense probably benign 0.19
R4436:Ddx24 UTSW 12 103423974 missense probably damaging 1.00
R4807:Ddx24 UTSW 12 103419461 missense probably damaging 1.00
R5568:Ddx24 UTSW 12 103424288 missense possibly damaging 0.46
R5629:Ddx24 UTSW 12 103425547 intron probably benign
R5763:Ddx24 UTSW 12 103417414 missense probably damaging 1.00
R5891:Ddx24 UTSW 12 103424058 missense probably damaging 1.00
R6059:Ddx24 UTSW 12 103408300 missense probably damaging 1.00
R6310:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6311:Ddx24 UTSW 12 103423907 missense probably damaging 1.00
R6408:Ddx24 UTSW 12 103425560 intron probably benign
R6648:Ddx24 UTSW 12 103408375 missense probably benign 0.02
R7151:Ddx24 UTSW 12 103424088 missense probably benign 0.00
R7299:Ddx24 UTSW 12 103419450 missense possibly damaging 0.95
R7301:Ddx24 UTSW 12 103419450 missense possibly damaging 0.95
R7324:Ddx24 UTSW 12 103416259 missense probably damaging 1.00
R7602:Ddx24 UTSW 12 103416260 nonsense probably null
R7734:Ddx24 UTSW 12 103417560 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GCATTCAGAGGTCTGCTTAGAAAC -3'
(R):5'- ACTGAATCTGGAGTGTTGCC -3'

Sequencing Primer
(F):5'- CAGAGGTCTGCTTAGAAACATTTAC -3'
(R):5'- CCTGAGGAGGCCAGAATTG -3'
Posted On2019-10-17