Mutagenetix > Incidental Mutations

Incidental Mutation 'R7513:Plxnb2'

582255

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R7513 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 89158322 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000051731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

Predicted Effect

probably null
Transcript: ENSMUST00000060808

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000109331

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	G	A	7: 131,272,071	G1709R	unknown	Het
Abcb1a	G	A	5: 8,715,771	W694*	probably null	Het
Accs	T	C	2: 93,840,092	N256S	possibly damaging	Het
Agmo	C	T	12: 37,244,353	T100I	probably benign	Het
Alox8	T	C	11: 69,187,844	D341G	probably benign	Het
Apol7c	T	A	15: 77,525,711	E345V	possibly damaging	Het
Arl5a	A	G	2: 52,412,145	F86L	possibly damaging	Het
AU040320	A	G	4: 126,792,264	E211G	probably benign	Het
B020011L13Rik	T	A	1: 117,801,419	C219S	probably damaging	Het
Btaf1	T	A	19: 36,978,403	L579Q	probably benign	Het
Cd84	T	A	1: 171,884,618	V267E	probably benign	Het
Clec11a	T	C	7: 44,306,356	E89G	probably benign	Het
Csrnp2	C	A	15: 100,482,416	E331D	probably benign	Het
Cyp2d12	C	A	15: 82,558,420	H355N	probably benign	Het
D3Ertd254e	T	A	3: 36,164,643	F272I	possibly damaging	Het
Ddx24	C	A	12: 103,419,106	G413*	probably null	Het
Dhx38	G	A	8: 109,560,589	P249L	probably benign	Het
Dip2a	A	T	10: 76,313,235	M233K	probably benign	Het
Dip2b	T	A	15: 100,207,748		probably null	Het
Dmbt1	T	C	7: 131,090,512	S1003P	unknown	Het
Dna2	A	G	10: 62,971,968	D1033G	probably benign	Het
Dnah5	T	C	15: 28,370,415	S2834P	probably benign	Het
Dnah7b	T	G	1: 46,124,346	S437A	probably benign	Het
Eif5	A	T	12: 111,540,252	I93F	probably damaging	Het
Fbxo47	A	G	11: 97,856,229	F337S	probably damaging	Het
Gm8765	T	A	13: 50,702,873	I849N	probably benign	Het
Helz	T	C	11: 107,656,115	I1086T	probably damaging	Het
Ifi208	A	T	1: 173,695,654	R497*	probably null	Het
Igfn1	T	G	1: 135,959,967	D2453A	probably damaging	Het
Ighg2c	A	T	12: 113,288,851	L27Q		Het
Jak1	C	T	4: 101,191,651	C10Y	probably damaging	Het
Kif7	T	A	7: 79,711,028	N200Y	possibly damaging	Het
Ktn1	G	C	14: 47,664,084	A100P	possibly damaging	Het
Lrsam1	T	C	2: 32,953,485	D136G	probably benign	Het
Man2c1	T	C	9: 57,139,399	L648P	probably benign	Het
Mki67	T	C	7: 135,693,223	I3116V	probably benign	Het
Mmp10	A	T	9: 7,508,127	D418V	probably damaging	Het
Mrpl24	A	T	3: 87,922,427	T107S	probably benign	Het
Mycbpap	T	A	11: 94,503,556	D296V	probably damaging	Het
Mycn	C	A	12: 12,939,742	A218S	probably benign	Het
Myo1f	G	T	17: 33,575,814	W9C	probably damaging	Het
Nckap1	T	A	2: 80,502,291	K1074N	possibly damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nhsl1	T	C	10: 18,523,952	S275P	probably damaging	Het
Olfr180	T	A	16: 58,915,932	K236N	probably damaging	Het
Olfr709-ps1	A	G	7: 106,927,276	F61S	possibly damaging	Het
Pam	G	A	1: 97,853,185	P514S	possibly damaging	Het
Pcdha4	C	T	18: 36,953,339	L192F	probably damaging	Het
Per1	T	A	11: 69,105,571	D800E	probably benign	Het
Plcg2	C	A	8: 117,579,853	N315K	probably damaging	Het
Pnpla1	A	G	17: 28,858,807		probably benign	Het
Pptc7	A	T	5: 122,308,129		probably null	Het
Psg26	G	T	7: 18,475,300	S394R	probably benign	Het
Psmc1	C	A	12: 100,115,514	T125K	probably benign	Het
Ptgis	T	A	2: 167,225,283	M125L	probably benign	Het
Rbms1	A	G	2: 60,758,821	Y323H	probably damaging	Het
Rgl2	G	A	17: 33,932,555	R191Q	probably benign	Het
Sirpb1a	G	A	3: 15,411,443	T98I	possibly damaging	Het
Sirpb1b	C	A	3: 15,542,140	E361*	probably null	Het
Slc13a4	A	T	6: 35,283,337		probably null	Het
Spag9	T	C	11: 94,112,083	S1140P	probably damaging	Het
Tas2r137	A	G	6: 40,492,150	N305D	probably damaging	Het
Tenm2	G	A	11: 36,051,900	A1314V	probably benign	Het
Tgm3	A	G	2: 130,024,404	T81A	probably benign	Het
Timeless	T	C	10: 128,249,530	V839A	probably damaging	Het
Tmem132a	A	G	19: 10,860,128	I606T	probably damaging	Het
Tox	T	A	4: 6,741,507	M158L	probably benign	Het
Trpc2	A	T	7: 102,090,068	M549L	probably damaging	Het
Trpm5	C	T	7: 143,081,835	R600Q	possibly damaging	Het
Trpv1	A	G	11: 73,240,541	N302D	probably damaging	Het
Ttn	C	T	2: 76,851,596	R1019H		Het
Ttn	G	T	2: 76,944,963	H1958N	unknown	Het
Usp32	A	T	11: 85,027,112	Y769*	probably null	Het
Vim	A	T	2: 13,578,632	Q255L	possibly damaging	Het
Vmn1r84	T	C	7: 12,362,067	H233R	probably benign	Het
Xirp2	T	A	2: 67,510,764	H1116Q	possibly damaging	Het
Zc3h18	G	T	8: 122,408,254	R580L	unknown	Het
Zfp442	A	T	2: 150,408,756	C409S	unknown	Het
Zfy1	A	T	Y: 759,852	I20K	unknown	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTAGTCCCAGTTCAGGTTGG -3'
(R):5'- TGACTTGGACCTTACCTCCCAG -3'

Sequencing Primer
(F):5'- CAGGGTCTTGGGGTCCACTAG -3'
(R):5'- CCTAAGCAAGGGGGATAGT -3'

Posted On

2019-10-17