Incidental Mutation 'R7513:Csrnp2'
ID582256
Institutional Source Beutler Lab
Gene Symbol Csrnp2
Ensembl Gene ENSMUSG00000044636
Gene Namecysteine-serine-rich nuclear protein 2
SynonymsCSRNP-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7513 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location100479570-100495488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100482416 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 331 (E331D)
Ref Sequence ENSEMBL: ENSMUSP00000052144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037001] [ENSMUST00000061457] [ENSMUST00000229012] [ENSMUST00000229648] [ENSMUST00000230294]
Predicted Effect probably benign
Transcript: ENSMUST00000037001
SMART Domains Protein: ENSMUSP00000037546
Gene: ENSMUSG00000037353

DomainStartEndE-ValueType
Pfam:LETM1 78 346 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061457
AA Change: E331D

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000052144
Gene: ENSMUSG00000044636
AA Change: E331D

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:CSRNP_N 61 280 5e-106 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229012
Predicted Effect probably benign
Transcript: ENSMUST00000229648
Predicted Effect probably benign
Transcript: ENSMUST00000230294
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CSRNP family of nuclear proteins that share conserved regions, including cysteine- and serine- rich regions, a basic domain, a transcriptional activation domain, and bind the sequence 'AGAGTG', thus have the hallmark of transcription factors. Studies in mice suggest that these genes may have redundant functions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy and display normal development, hematopoiesis and T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,272,071 G1709R unknown Het
Abcb1a G A 5: 8,715,771 W694* probably null Het
Accs T C 2: 93,840,092 N256S possibly damaging Het
Agmo C T 12: 37,244,353 T100I probably benign Het
Alox8 T C 11: 69,187,844 D341G probably benign Het
Apol7c T A 15: 77,525,711 E345V possibly damaging Het
Arl5a A G 2: 52,412,145 F86L possibly damaging Het
AU040320 A G 4: 126,792,264 E211G probably benign Het
B020011L13Rik T A 1: 117,801,419 C219S probably damaging Het
Btaf1 T A 19: 36,978,403 L579Q probably benign Het
Cd84 T A 1: 171,884,618 V267E probably benign Het
Clec11a T C 7: 44,306,356 E89G probably benign Het
Cyp2d12 C A 15: 82,558,420 H355N probably benign Het
D3Ertd254e T A 3: 36,164,643 F272I possibly damaging Het
Ddx24 C A 12: 103,419,106 G413* probably null Het
Dhx38 G A 8: 109,560,589 P249L probably benign Het
Dip2a A T 10: 76,313,235 M233K probably benign Het
Dip2b T A 15: 100,207,748 probably null Het
Dmbt1 T C 7: 131,090,512 S1003P unknown Het
Dna2 A G 10: 62,971,968 D1033G probably benign Het
Dnah5 T C 15: 28,370,415 S2834P probably benign Het
Dnah7b T G 1: 46,124,346 S437A probably benign Het
Eif5 A T 12: 111,540,252 I93F probably damaging Het
Fbxo47 A G 11: 97,856,229 F337S probably damaging Het
Gm8765 T A 13: 50,702,873 I849N probably benign Het
Helz T C 11: 107,656,115 I1086T probably damaging Het
Ifi208 A T 1: 173,695,654 R497* probably null Het
Igfn1 T G 1: 135,959,967 D2453A probably damaging Het
Ighg2c A T 12: 113,288,851 L27Q Het
Jak1 C T 4: 101,191,651 C10Y probably damaging Het
Kif7 T A 7: 79,711,028 N200Y possibly damaging Het
Ktn1 G C 14: 47,664,084 A100P possibly damaging Het
Lrsam1 T C 2: 32,953,485 D136G probably benign Het
Man2c1 T C 9: 57,139,399 L648P probably benign Het
Mki67 T C 7: 135,693,223 I3116V probably benign Het
Mmp10 A T 9: 7,508,127 D418V probably damaging Het
Mrpl24 A T 3: 87,922,427 T107S probably benign Het
Mycbpap T A 11: 94,503,556 D296V probably damaging Het
Mycn C A 12: 12,939,742 A218S probably benign Het
Myo1f G T 17: 33,575,814 W9C probably damaging Het
Nckap1 T A 2: 80,502,291 K1074N possibly damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nhsl1 T C 10: 18,523,952 S275P probably damaging Het
Olfr180 T A 16: 58,915,932 K236N probably damaging Het
Olfr709-ps1 A G 7: 106,927,276 F61S possibly damaging Het
Pam G A 1: 97,853,185 P514S possibly damaging Het
Pcdha4 C T 18: 36,953,339 L192F probably damaging Het
Per1 T A 11: 69,105,571 D800E probably benign Het
Plcg2 C A 8: 117,579,853 N315K probably damaging Het
Plxnb2 T A 15: 89,158,322 probably null Het
Pnpla1 A G 17: 28,858,807 probably benign Het
Pptc7 A T 5: 122,308,129 probably null Het
Psg26 G T 7: 18,475,300 S394R probably benign Het
Psmc1 C A 12: 100,115,514 T125K probably benign Het
Ptgis T A 2: 167,225,283 M125L probably benign Het
Rbms1 A G 2: 60,758,821 Y323H probably damaging Het
Rgl2 G A 17: 33,932,555 R191Q probably benign Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Sirpb1b C A 3: 15,542,140 E361* probably null Het
Slc13a4 A T 6: 35,283,337 probably null Het
Spag9 T C 11: 94,112,083 S1140P probably damaging Het
Tas2r137 A G 6: 40,492,150 N305D probably damaging Het
Tenm2 G A 11: 36,051,900 A1314V probably benign Het
Tgm3 A G 2: 130,024,404 T81A probably benign Het
Timeless T C 10: 128,249,530 V839A probably damaging Het
Tmem132a A G 19: 10,860,128 I606T probably damaging Het
Tox T A 4: 6,741,507 M158L probably benign Het
Trpc2 A T 7: 102,090,068 M549L probably damaging Het
Trpm5 C T 7: 143,081,835 R600Q possibly damaging Het
Trpv1 A G 11: 73,240,541 N302D probably damaging Het
Ttn G T 2: 76,944,963 H1958N unknown Het
Ttn C T 2: 76,851,596 R1019H Het
Usp32 A T 11: 85,027,112 Y769* probably null Het
Vim A T 2: 13,578,632 Q255L possibly damaging Het
Vmn1r84 T C 7: 12,362,067 H233R probably benign Het
Xirp2 T A 2: 67,510,764 H1116Q possibly damaging Het
Zc3h18 G T 8: 122,408,254 R580L unknown Het
Zfp442 A T 2: 150,408,756 C409S unknown Het
Zfy1 A T Y: 759,852 I20K unknown Het
Other mutations in Csrnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Csrnp2 APN 15 100484643 missense probably benign 0.21
R0674:Csrnp2 UTSW 15 100487991 missense probably damaging 1.00
R1988:Csrnp2 UTSW 15 100489440 missense probably damaging 1.00
R3683:Csrnp2 UTSW 15 100481998 missense probably benign
R4688:Csrnp2 UTSW 15 100482360 missense probably damaging 0.97
R4846:Csrnp2 UTSW 15 100484690 missense probably damaging 1.00
R5429:Csrnp2 UTSW 15 100482054 missense probably benign
R5678:Csrnp2 UTSW 15 100481804 makesense probably null
R6056:Csrnp2 UTSW 15 100482382 missense probably benign 0.23
R6765:Csrnp2 UTSW 15 100482693 missense probably damaging 1.00
R6925:Csrnp2 UTSW 15 100481958 missense probably benign 0.03
R7697:Csrnp2 UTSW 15 100488072 missense probably damaging 1.00
R8081:Csrnp2 UTSW 15 100489581 missense probably damaging 0.98
X0020:Csrnp2 UTSW 15 100484703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGTAAAACACAGGACGG -3'
(R):5'- GGGCGAATTGAGTTTAACCCG -3'

Sequencing Primer
(F):5'- CACAGGACGGAGGAACCTG -3'
(R):5'- AGTTTAACCCGATCCGAGTG -3'
Posted On2019-10-17