Incidental Mutation 'R7513:Rgl2'
ID582260
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Nameral guanine nucleotide dissociation stimulator-like 2
SynonymsKE1.5, Rab2l, Rgt2, Rlf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7513 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33929543-33937687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33932555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 191 (R191Q)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
PDB Structure
STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: R191Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: R191Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,272,071 G1709R unknown Het
Abcb1a G A 5: 8,715,771 W694* probably null Het
Accs T C 2: 93,840,092 N256S possibly damaging Het
Agmo C T 12: 37,244,353 T100I probably benign Het
Alox8 T C 11: 69,187,844 D341G probably benign Het
Apol7c T A 15: 77,525,711 E345V possibly damaging Het
Arl5a A G 2: 52,412,145 F86L possibly damaging Het
AU040320 A G 4: 126,792,264 E211G probably benign Het
B020011L13Rik T A 1: 117,801,419 C219S probably damaging Het
Btaf1 T A 19: 36,978,403 L579Q probably benign Het
Cd84 T A 1: 171,884,618 V267E probably benign Het
Clec11a T C 7: 44,306,356 E89G probably benign Het
Csrnp2 C A 15: 100,482,416 E331D probably benign Het
Cyp2d12 C A 15: 82,558,420 H355N probably benign Het
D3Ertd254e T A 3: 36,164,643 F272I possibly damaging Het
Ddx24 C A 12: 103,419,106 G413* probably null Het
Dhx38 G A 8: 109,560,589 P249L probably benign Het
Dip2a A T 10: 76,313,235 M233K probably benign Het
Dip2b T A 15: 100,207,748 probably null Het
Dmbt1 T C 7: 131,090,512 S1003P unknown Het
Dna2 A G 10: 62,971,968 D1033G probably benign Het
Dnah5 T C 15: 28,370,415 S2834P probably benign Het
Dnah7b T G 1: 46,124,346 S437A probably benign Het
Eif5 A T 12: 111,540,252 I93F probably damaging Het
Fbxo47 A G 11: 97,856,229 F337S probably damaging Het
Gm8765 T A 13: 50,702,873 I849N probably benign Het
Helz T C 11: 107,656,115 I1086T probably damaging Het
Ifi208 A T 1: 173,695,654 R497* probably null Het
Igfn1 T G 1: 135,959,967 D2453A probably damaging Het
Ighg2c A T 12: 113,288,851 L27Q Het
Jak1 C T 4: 101,191,651 C10Y probably damaging Het
Kif7 T A 7: 79,711,028 N200Y possibly damaging Het
Ktn1 G C 14: 47,664,084 A100P possibly damaging Het
Lrsam1 T C 2: 32,953,485 D136G probably benign Het
Man2c1 T C 9: 57,139,399 L648P probably benign Het
Mki67 T C 7: 135,693,223 I3116V probably benign Het
Mmp10 A T 9: 7,508,127 D418V probably damaging Het
Mrpl24 A T 3: 87,922,427 T107S probably benign Het
Mycbpap T A 11: 94,503,556 D296V probably damaging Het
Mycn C A 12: 12,939,742 A218S probably benign Het
Myo1f G T 17: 33,575,814 W9C probably damaging Het
Nckap1 T A 2: 80,502,291 K1074N possibly damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nhsl1 T C 10: 18,523,952 S275P probably damaging Het
Olfr180 T A 16: 58,915,932 K236N probably damaging Het
Olfr709-ps1 A G 7: 106,927,276 F61S possibly damaging Het
Pam G A 1: 97,853,185 P514S possibly damaging Het
Pcdha4 C T 18: 36,953,339 L192F probably damaging Het
Per1 T A 11: 69,105,571 D800E probably benign Het
Plcg2 C A 8: 117,579,853 N315K probably damaging Het
Plxnb2 T A 15: 89,158,322 probably null Het
Pnpla1 A G 17: 28,858,807 probably benign Het
Pptc7 A T 5: 122,308,129 probably null Het
Psg26 G T 7: 18,475,300 S394R probably benign Het
Psmc1 C A 12: 100,115,514 T125K probably benign Het
Ptgis T A 2: 167,225,283 M125L probably benign Het
Rbms1 A G 2: 60,758,821 Y323H probably damaging Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Sirpb1b C A 3: 15,542,140 E361* probably null Het
Slc13a4 A T 6: 35,283,337 probably null Het
Spag9 T C 11: 94,112,083 S1140P probably damaging Het
Tas2r137 A G 6: 40,492,150 N305D probably damaging Het
Tenm2 G A 11: 36,051,900 A1314V probably benign Het
Tgm3 A G 2: 130,024,404 T81A probably benign Het
Timeless T C 10: 128,249,530 V839A probably damaging Het
Tmem132a A G 19: 10,860,128 I606T probably damaging Het
Tox T A 4: 6,741,507 M158L probably benign Het
Trpc2 A T 7: 102,090,068 M549L probably damaging Het
Trpm5 C T 7: 143,081,835 R600Q possibly damaging Het
Trpv1 A G 11: 73,240,541 N302D probably damaging Het
Ttn C T 2: 76,851,596 R1019H Het
Ttn G T 2: 76,944,963 H1958N unknown Het
Usp32 A T 11: 85,027,112 Y769* probably null Het
Vim A T 2: 13,578,632 Q255L possibly damaging Het
Vmn1r84 T C 7: 12,362,067 H233R probably benign Het
Xirp2 T A 2: 67,510,764 H1116Q possibly damaging Het
Zc3h18 G T 8: 122,408,254 R580L unknown Het
Zfp442 A T 2: 150,408,756 C409S unknown Het
Zfy1 A T Y: 759,852 I20K unknown Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 33933136 missense probably benign 0.31
IGL00898:Rgl2 APN 17 33933418 missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 33935936 missense probably benign 0.00
IGL00985:Rgl2 APN 17 33932101 missense probably damaging 1.00
IGL02140:Rgl2 APN 17 33933124 missense probably damaging 1.00
IGL02214:Rgl2 APN 17 33935189 missense probably benign 0.06
IGL02486:Rgl2 APN 17 33935980 missense probably damaging 0.97
IGL02579:Rgl2 APN 17 33937160 missense probably benign 0.08
IGL02976:Rgl2 APN 17 33933962 missense possibly damaging 0.95
Pedernales UTSW 17 33932038 critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 33933940 missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 33932738 missense probably damaging 1.00
R0456:Rgl2 UTSW 17 33936849 splice site probably null
R0825:Rgl2 UTSW 17 33935159 splice site probably null
R1742:Rgl2 UTSW 17 33937223 unclassified probably null
R1777:Rgl2 UTSW 17 33931744 missense probably benign 0.00
R1829:Rgl2 UTSW 17 33933621 missense probably benign 0.00
R1908:Rgl2 UTSW 17 33932148 missense probably benign 0.00
R1961:Rgl2 UTSW 17 33933615 missense probably damaging 1.00
R2102:Rgl2 UTSW 17 33933340 splice site probably null
R3001:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3002:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3755:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3756:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3978:Rgl2 UTSW 17 33935162 missense probably benign 0.02
R4042:Rgl2 UTSW 17 33937262 missense probably damaging 1.00
R4064:Rgl2 UTSW 17 33937108 missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 33936932 missense probably benign 0.04
R4661:Rgl2 UTSW 17 33933226 missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 33937173 missense probably benign 0.00
R4922:Rgl2 UTSW 17 33932775 unclassified probably benign
R5119:Rgl2 UTSW 17 33937120 missense probably benign 0.00
R5167:Rgl2 UTSW 17 33935974 nonsense probably null
R5279:Rgl2 UTSW 17 33935948 missense probably benign
R5319:Rgl2 UTSW 17 33933555 missense probably benign 0.02
R5337:Rgl2 UTSW 17 33934984 missense probably damaging 0.99
R5881:Rgl2 UTSW 17 33932717 missense probably benign 0.01
R5945:Rgl2 UTSW 17 33932038 critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 33931765 missense probably benign 0.01
R6358:Rgl2 UTSW 17 33937131 unclassified probably null
R6867:Rgl2 UTSW 17 33932687 missense probably benign 0.09
R7174:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7203:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7250:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7253:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7455:Rgl2 UTSW 17 33932683 missense probably benign 0.32
R7752:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7984:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
X0028:Rgl2 UTSW 17 33932458 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGAATCTCATCCTCCCGGTG -3'
(R):5'- TCTAGCAGGGTCAGCTGTTC -3'

Sequencing Primer
(F):5'- TGAGTGGCCCTGTCTGAAC -3'
(R):5'- TCAGCTGTTCGGCCAAGTG -3'
Posted On2019-10-17