Incidental Mutation 'R7513:Rgl2'
ID 582260
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 045586-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R7513 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34151529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 191 (R191Q)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: R191Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: R191Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,765,771 (GRCm39) W694* probably null Het
Accs T C 2: 93,670,437 (GRCm39) N256S possibly damaging Het
Agmo C T 12: 37,294,352 (GRCm39) T100I probably benign Het
Alox8 T C 11: 69,078,670 (GRCm39) D341G probably benign Het
Apol7c T A 15: 77,409,911 (GRCm39) E345V possibly damaging Het
Arl5a A G 2: 52,302,157 (GRCm39) F86L possibly damaging Het
AU040320 A G 4: 126,686,057 (GRCm39) E211G probably benign Het
B020011L13Rik T A 1: 117,729,149 (GRCm39) C219S probably damaging Het
Btaf1 T A 19: 36,955,803 (GRCm39) L579Q probably benign Het
Cd84 T A 1: 171,712,185 (GRCm39) V267E probably benign Het
Cdcp3 G A 7: 130,873,800 (GRCm39) G1709R unknown Het
Clec11a T C 7: 43,955,780 (GRCm39) E89G probably benign Het
Csrnp2 C A 15: 100,380,297 (GRCm39) E331D probably benign Het
Cyp2d12 C A 15: 82,442,621 (GRCm39) H355N probably benign Het
Ddx24 C A 12: 103,385,365 (GRCm39) G413* probably null Het
Dhx38 G A 8: 110,287,221 (GRCm39) P249L probably benign Het
Dip2a A T 10: 76,149,069 (GRCm39) M233K probably benign Het
Dip2b T A 15: 100,105,629 (GRCm39) probably null Het
Dmbt1 T C 7: 130,692,242 (GRCm39) S1003P unknown Het
Dna2 A G 10: 62,807,747 (GRCm39) D1033G probably benign Het
Dnah5 T C 15: 28,370,561 (GRCm39) S2834P probably benign Het
Dnah7b T G 1: 46,163,506 (GRCm39) S437A probably benign Het
Eif5 A T 12: 111,506,686 (GRCm39) I93F probably damaging Het
Fbxo47 A G 11: 97,747,055 (GRCm39) F337S probably damaging Het
Helz T C 11: 107,546,941 (GRCm39) I1086T probably damaging Het
Ifi208 A T 1: 173,523,220 (GRCm39) R497* probably null Het
Igfn1 T G 1: 135,887,705 (GRCm39) D2453A probably damaging Het
Ighg2c A T 12: 113,252,471 (GRCm39) L27Q Het
Jak1 C T 4: 101,048,848 (GRCm39) C10Y probably damaging Het
Kif7 T A 7: 79,360,776 (GRCm39) N200Y possibly damaging Het
Ktn1 G C 14: 47,901,541 (GRCm39) A100P possibly damaging Het
Lrsam1 T C 2: 32,843,497 (GRCm39) D136G probably benign Het
Man2c1 T C 9: 57,046,683 (GRCm39) L648P probably benign Het
Mki67 T C 7: 135,294,952 (GRCm39) I3116V probably benign Het
Mmp10 A T 9: 7,508,128 (GRCm39) D418V probably damaging Het
Mrpl24 A T 3: 87,829,734 (GRCm39) T107S probably benign Het
Mycbpap T A 11: 94,394,382 (GRCm39) D296V probably damaging Het
Mycn C A 12: 12,989,743 (GRCm39) A218S probably benign Het
Myo1f G T 17: 33,794,788 (GRCm39) W9C probably damaging Het
Nckap1 T A 2: 80,332,635 (GRCm39) K1074N possibly damaging Het
Neb T C 2: 52,099,552 (GRCm39) D4766G possibly damaging Het
Nhsl1 T C 10: 18,399,700 (GRCm39) S275P probably damaging Het
Or2d3c A G 7: 106,526,483 (GRCm39) F61S possibly damaging Het
Or5k16 T A 16: 58,736,295 (GRCm39) K236N probably damaging Het
Pam G A 1: 97,780,910 (GRCm39) P514S possibly damaging Het
Pcdha4 C T 18: 37,086,392 (GRCm39) L192F probably damaging Het
Per1 T A 11: 68,996,397 (GRCm39) D800E probably benign Het
Plcg2 C A 8: 118,306,592 (GRCm39) N315K probably damaging Het
Plxnb2 T A 15: 89,042,525 (GRCm39) probably null Het
Pnpla1 A G 17: 29,077,781 (GRCm39) probably benign Het
Pptc7 A T 5: 122,446,192 (GRCm39) probably null Het
Psg26 G T 7: 18,209,225 (GRCm39) S394R probably benign Het
Psmc1 C A 12: 100,081,773 (GRCm39) T125K probably benign Het
Ptgis T A 2: 167,067,203 (GRCm39) M125L probably benign Het
Rbms1 A G 2: 60,589,165 (GRCm39) Y323H probably damaging Het
Sirpb1a G A 3: 15,476,503 (GRCm39) T98I possibly damaging Het
Sirpb1b C A 3: 15,607,200 (GRCm39) E361* probably null Het
Slc13a4 A T 6: 35,260,272 (GRCm39) probably null Het
Spag9 T C 11: 94,002,909 (GRCm39) S1140P probably damaging Het
Spata31e4 T A 13: 50,856,909 (GRCm39) I849N probably benign Het
Tas2r140 A G 6: 40,469,084 (GRCm39) N305D probably damaging Het
Tenm2 G A 11: 35,942,727 (GRCm39) A1314V probably benign Het
Tgm3 A G 2: 129,866,324 (GRCm39) T81A probably benign Het
Timeless T C 10: 128,085,399 (GRCm39) V839A probably damaging Het
Tmem132a A G 19: 10,837,492 (GRCm39) I606T probably damaging Het
Tox T A 4: 6,741,507 (GRCm39) M158L probably benign Het
Trpc2 A T 7: 101,739,275 (GRCm39) M549L probably damaging Het
Trpm5 C T 7: 142,635,572 (GRCm39) R600Q possibly damaging Het
Trpv1 A G 11: 73,131,367 (GRCm39) N302D probably damaging Het
Ttn C T 2: 76,681,940 (GRCm39) R1019H Het
Ttn G T 2: 76,775,307 (GRCm39) H1958N unknown Het
Usp32 A T 11: 84,917,938 (GRCm39) Y769* probably null Het
Vim A T 2: 13,583,443 (GRCm39) Q255L possibly damaging Het
Vmn1r84 T C 7: 12,095,994 (GRCm39) H233R probably benign Het
Xirp2 T A 2: 67,341,108 (GRCm39) H1116Q possibly damaging Het
Zc3h18 G T 8: 123,134,993 (GRCm39) R580L unknown Het
Zfp267 T A 3: 36,218,792 (GRCm39) F272I possibly damaging Het
Zfp442 A T 2: 150,250,676 (GRCm39) C409S unknown Het
Zfy1 A T Y: 759,852 (GRCm39) I20K unknown Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAATCTCATCCTCCCGGTG -3'
(R):5'- TCTAGCAGGGTCAGCTGTTC -3'

Sequencing Primer
(F):5'- TGAGTGGCCCTGTCTGAAC -3'
(R):5'- TCAGCTGTTCGGCCAAGTG -3'
Posted On 2019-10-17