Incidental Mutation 'R7514:Dnah14'
ID582276
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7514 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181628067 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 919 (I919T)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: I919T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,802 L261P probably damaging Het
A4gnt A G 9: 99,620,545 I253V probably benign Het
Acap2 A T 16: 31,154,567 probably null Het
Adora2b G T 11: 62,265,320 M198I probably damaging Het
Akap5 C A 12: 76,328,529 T245K probably benign Het
Aldh1a2 T C 9: 71,284,963 I399T probably damaging Het
Ank2 G A 3: 127,025,603 S473L probably benign Het
Anln A T 9: 22,360,857 D655E probably damaging Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
Arid1b A G 17: 5,341,714 K1787E probably benign Het
Art4 T C 6: 136,854,741 H134R probably benign Het
Borcs6 G A 11: 69,060,584 V263M probably damaging Het
C8a A T 4: 104,846,050 M314K possibly damaging Het
Cbfa2t3 T G 8: 122,635,126 M386L probably damaging Het
Ccdc170 T A 10: 4,546,839 V459E probably benign Het
Cdh4 T A 2: 179,890,843 N699K possibly damaging Het
Cdk12 T C 11: 98,222,658 L756P unknown Het
Chsy1 A G 7: 66,172,120 D701G probably damaging Het
Cnot9 A G 1: 74,528,762 T270A probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyb5r1 A G 1: 134,410,530 E228G probably damaging Het
D630003M21Rik A G 2: 158,217,353 L209P probably damaging Het
Dennd2c T A 3: 103,163,062 D791E probably benign Het
Dpp8 T C 9: 65,078,754 L842S probably damaging Het
Ern1 A G 11: 106,409,893 probably null Het
Exo1 T C 1: 175,906,666 probably null Het
Fam161b T G 12: 84,357,738 E56A possibly damaging Het
Fbrsl1 T C 5: 110,432,933 T153A probably benign Het
Fcgr3 T G 1: 171,059,343 D4A probably benign Het
Gltp C T 5: 114,670,460 A193T probably benign Het
Gm10031 A G 1: 156,524,754 D175G probably benign Het
Gm13178 A T 4: 144,703,228 V397D possibly damaging Het
Gm3159 A T 14: 4,399,690 S142C probably damaging Het
Gphn T C 12: 78,626,165 V485A probably damaging Het
Grik2 A T 10: 49,523,808 N275K probably damaging Het
Gstt3 G T 10: 75,776,791 Q102K probably damaging Het
Hivep3 T A 4: 120,096,855 F789L possibly damaging Het
Ing5 A G 1: 93,816,442 N157D possibly damaging Het
Itga3 C T 11: 95,065,896 W177* probably null Het
Jag2 T C 12: 112,929,052 T83A probably benign Het
Krt90 G A 15: 101,553,170 T532I unknown Het
Lcn2 A G 2: 32,387,849 probably null Het
Lrig2 A G 3: 104,465,760 S602P probably damaging Het
Lsm1 A C 8: 25,792,209 R33S probably damaging Het
Mast4 A T 13: 102,787,426 Y492* probably null Het
Mcm3 A T 1: 20,805,896 L658Q probably benign Het
Myh4 G A 11: 67,243,322 probably null Het
Nck2 T C 1: 43,569,221 V341A probably benign Het
Nucb1 T C 7: 45,501,718 probably null Het
Nup210l G C 3: 90,210,459 probably null Het
Olfr1039 A T 2: 86,131,628 F12I probably damaging Het
Olfr3 A G 2: 36,812,639 I151T probably benign Het
Olfr837 A T 9: 19,137,865 S291C possibly damaging Het
Olfr912 T A 9: 38,582,051 M258K probably damaging Het
Olfr921 G A 9: 38,775,678 C141Y probably damaging Het
Pla2g4a G A 1: 149,851,362 P556S probably damaging Het
Plat T C 8: 22,775,642 C234R probably damaging Het
Ppfia1 T C 7: 144,517,713 I321V probably benign Het
Prrc1 T A 18: 57,363,253 V92E probably benign Het
Prss3 A G 6: 41,373,914 V214A probably damaging Het
Ptprg G T 14: 12,179,342 K786N possibly damaging Het
Rabgap1 G T 2: 37,537,342 G645V probably damaging Het
Rfx4 T C 10: 84,880,226 S470P probably damaging Het
Rin3 C T 12: 102,369,650 Q607* probably null Het
Sema3a A G 5: 13,523,126 H207R probably benign Het
Serpinb12 G A 1: 106,950,804 E181K probably damaging Het
Serpinb6c G A 13: 33,897,403 Q88* probably null Het
Shmt1 A C 11: 60,801,986 C90W probably damaging Het
Slc16a13 C T 11: 70,218,884 V264M probably damaging Het
Slc17a8 G T 10: 89,592,107 P286Q probably damaging Het
Slc27a6 C T 18: 58,612,221 Q576* probably null Het
Slc30a9 T C 5: 67,348,078 S470P possibly damaging Het
Slc44a2 G T 9: 21,342,472 K136N possibly damaging Het
Smarca5 A T 8: 80,717,534 H534Q probably damaging Het
Son T G 16: 91,654,860 L165R probably damaging Het
Sox10 G A 15: 79,156,221 P373L probably benign Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Srrm4 A G 5: 116,446,511 L500P probably damaging Het
Tap1 T C 17: 34,196,665 L689P probably damaging Het
Tfg A G 16: 56,705,609 probably null Het
Tjp2 C T 19: 24,111,522 V677I probably benign Het
Tmprss11g T G 5: 86,497,317 D85A probably damaging Het
Tnfsf9 T C 17: 57,107,238 S222P probably damaging Het
Trank1 A G 9: 111,364,756 N616S probably damaging Het
Tubgcp6 C A 15: 89,120,525 W297L probably damaging Het
Twist1 T C 12: 33,958,356 S127P probably damaging Het
Ubr4 T C 4: 139,452,655 I247T unknown Het
Ubr5 G A 15: 37,988,237 T2153M Het
Utrn A G 10: 12,698,089 V1079A probably benign Het
Vcan T C 13: 89,704,118 T908A probably damaging Het
Vmn2r104 A G 17: 20,029,529 F827L probably damaging Het
Vmn2r111 T A 17: 22,548,399 T706S probably benign Het
Vmn2r114 T C 17: 23,308,061 D499G probably null Het
Vmn2r92 T C 17: 18,171,271 S512P probably damaging Het
Vps4b A T 1: 106,780,502 probably null Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt10b T C 15: 98,774,164 Q224R probably benign Het
Ylpm1 C T 12: 85,030,494 P1331L possibly damaging Het
Zfhx4 G A 3: 5,242,207 M164I possibly damaging Het
Zfp51 A G 17: 21,463,500 T126A probably benign Het
Zfp609 A G 9: 65,706,136 V339A probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Zfyve21 C T 12: 111,823,815 L84F probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 intron probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAGAACTCCTCTCCTGCTGGC -3'
(R):5'- AATTGCCTTGCCTCTGGTG -3'

Sequencing Primer
(F):5'- TGGCCGCCAGTACTCCAATAC -3'
(R):5'- GGAGAAGCACACATTACCTTTTTCC -3'
Posted On2019-10-17