Incidental Mutation 'R7514:Nup210l'
ID 582285
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission 045587-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R7514 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to C at 90117766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000107373] [ENSMUST00000170122] [ENSMUST00000195998] [ENSMUST00000196205] [ENSMUST00000197361] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably null
Transcript: ENSMUST00000029548
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107373
SMART Domains Protein: ENSMUSP00000102996
Gene: ENSMUSG00000027935

DomainStartEndE-ValueType
Pfam:Miro 1 43 3.5e-6 PFAM
Pfam:Arf 1 88 1.8e-5 PFAM
Pfam:Ras 1 90 2.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170122
SMART Domains Protein: ENSMUSP00000132102
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:Ribosomal_S27e 28 82 9.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195998
SMART Domains Protein: ENSMUSP00000142942
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
Pfam:Ribosomal_S27e 1 50 3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196205
SMART Domains Protein: ENSMUSP00000142536
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
Pfam:Ribosomal_S27e 26 80 7.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197361
SMART Domains Protein: ENSMUSP00000143402
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:Ribosomal_S27e 28 80 5.7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200410
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,086,628 (GRCm39) L261P probably damaging Het
A4gnt A G 9: 99,502,598 (GRCm39) I253V probably benign Het
AAdacl4fm3 A T 4: 144,429,798 (GRCm39) V397D possibly damaging Het
Acap2 A T 16: 30,973,385 (GRCm39) probably null Het
Adora2b G T 11: 62,156,146 (GRCm39) M198I probably damaging Het
Akap5 C A 12: 76,375,303 (GRCm39) T245K probably benign Het
Aldh1a2 T C 9: 71,192,245 (GRCm39) I399T probably damaging Het
Ank2 G A 3: 126,819,252 (GRCm39) S473L probably benign Het
Anln A T 9: 22,272,153 (GRCm39) D655E probably damaging Het
Arhgef10 T C 8: 15,025,956 (GRCm39) V820A probably benign Het
Arid1b A G 17: 5,391,989 (GRCm39) K1787E probably benign Het
Art4 T C 6: 136,831,739 (GRCm39) H134R probably benign Het
Borcs6 G A 11: 68,951,410 (GRCm39) V263M probably damaging Het
C8a A T 4: 104,703,247 (GRCm39) M314K possibly damaging Het
Cbfa2t3 T G 8: 123,361,865 (GRCm39) M386L probably damaging Het
Ccdc170 T A 10: 4,496,839 (GRCm39) V459E probably benign Het
Cdh4 T A 2: 179,532,636 (GRCm39) N699K possibly damaging Het
Cdk12 T C 11: 98,113,484 (GRCm39) L756P unknown Het
Chsy1 A G 7: 65,821,868 (GRCm39) D701G probably damaging Het
Cnot9 A G 1: 74,567,921 (GRCm39) T270A probably benign Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Csnk2a1-ps3 A G 1: 156,352,324 (GRCm39) D175G probably benign Het
Cyb5r1 A G 1: 134,338,268 (GRCm39) E228G probably damaging Het
D630003M21Rik A G 2: 158,059,273 (GRCm39) L209P probably damaging Het
Dennd2c T A 3: 103,070,378 (GRCm39) D791E probably benign Het
Dnah14 T C 1: 181,455,632 (GRCm39) I919T probably damaging Het
Dpp8 T C 9: 64,986,036 (GRCm39) L842S probably damaging Het
Ern1 A G 11: 106,300,719 (GRCm39) probably null Het
Exo1 T C 1: 175,734,232 (GRCm39) probably null Het
Fam161b T G 12: 84,404,512 (GRCm39) E56A possibly damaging Het
Fbrsl1 T C 5: 110,580,799 (GRCm39) T153A probably benign Het
Fcgr3 T G 1: 170,886,912 (GRCm39) D4A probably benign Het
Gltp C T 5: 114,808,521 (GRCm39) A193T probably benign Het
Gm3159 A T 14: 4,399,690 (GRCm38) S142C probably damaging Het
Gphn T C 12: 78,672,939 (GRCm39) V485A probably damaging Het
Grik2 A T 10: 49,399,904 (GRCm39) N275K probably damaging Het
Gstt3 G T 10: 75,612,625 (GRCm39) Q102K probably damaging Het
Hivep3 T A 4: 119,954,052 (GRCm39) F789L possibly damaging Het
Ing5 A G 1: 93,744,164 (GRCm39) N157D possibly damaging Het
Itga3 C T 11: 94,956,722 (GRCm39) W177* probably null Het
Jag2 T C 12: 112,892,672 (GRCm39) T83A probably benign Het
Krt90 G A 15: 101,461,605 (GRCm39) T532I unknown Het
Lcn2 A G 2: 32,277,861 (GRCm39) probably null Het
Lrig2 A G 3: 104,373,076 (GRCm39) S602P probably damaging Het
Lsm1 A C 8: 26,282,237 (GRCm39) R33S probably damaging Het
Mast4 A T 13: 102,923,934 (GRCm39) Y492* probably null Het
Mcm3 A T 1: 20,876,120 (GRCm39) L658Q probably benign Het
Myh4 G A 11: 67,134,148 (GRCm39) probably null Het
Nck2 T C 1: 43,608,381 (GRCm39) V341A probably benign Het
Nucb1 T C 7: 45,151,142 (GRCm39) probably null Het
Or1j1 A G 2: 36,702,651 (GRCm39) I151T probably benign Het
Or5al5 A T 2: 85,961,972 (GRCm39) F12I probably damaging Het
Or7g22 A T 9: 19,049,161 (GRCm39) S291C possibly damaging Het
Or8b48 T A 9: 38,493,347 (GRCm39) M258K probably damaging Het
Or8b54 G A 9: 38,686,974 (GRCm39) C141Y probably damaging Het
Pla2g4a G A 1: 149,727,113 (GRCm39) P556S probably damaging Het
Plat T C 8: 23,265,658 (GRCm39) C234R probably damaging Het
Ppfia1 T C 7: 144,071,450 (GRCm39) I321V probably benign Het
Prrc1 T A 18: 57,496,325 (GRCm39) V92E probably benign Het
Prss3 A G 6: 41,350,848 (GRCm39) V214A probably damaging Het
Ptprg G T 14: 12,179,342 (GRCm38) K786N possibly damaging Het
Rabgap1 G T 2: 37,427,354 (GRCm39) G645V probably damaging Het
Rfx4 T C 10: 84,716,090 (GRCm39) S470P probably damaging Het
Rin3 C T 12: 102,335,909 (GRCm39) Q607* probably null Het
Sema3a A G 5: 13,573,093 (GRCm39) H207R probably benign Het
Serpinb12 G A 1: 106,878,534 (GRCm39) E181K probably damaging Het
Serpinb6c G A 13: 34,081,386 (GRCm39) Q88* probably null Het
Shmt1 A C 11: 60,692,812 (GRCm39) C90W probably damaging Het
Slc16a13 C T 11: 70,109,710 (GRCm39) V264M probably damaging Het
Slc17a8 G T 10: 89,427,969 (GRCm39) P286Q probably damaging Het
Slc27a6 C T 18: 58,745,293 (GRCm39) Q576* probably null Het
Slc30a9 T C 5: 67,505,421 (GRCm39) S470P possibly damaging Het
Slc44a2 G T 9: 21,253,768 (GRCm39) K136N possibly damaging Het
Smarca5 A T 8: 81,444,163 (GRCm39) H534Q probably damaging Het
Son T G 16: 91,451,748 (GRCm39) L165R probably damaging Het
Sox10 G A 15: 79,040,421 (GRCm39) P373L probably benign Het
Sp100 C T 1: 85,608,860 (GRCm39) R330* probably null Het
Srrm4 A G 5: 116,584,570 (GRCm39) L500P probably damaging Het
Tap1 T C 17: 34,415,639 (GRCm39) L689P probably damaging Het
Tfg A G 16: 56,525,972 (GRCm39) probably null Het
Tjp2 C T 19: 24,088,886 (GRCm39) V677I probably benign Het
Tmprss11g T G 5: 86,645,176 (GRCm39) D85A probably damaging Het
Tnfsf9 T C 17: 57,414,238 (GRCm39) S222P probably damaging Het
Trank1 A G 9: 111,193,824 (GRCm39) N616S probably damaging Het
Tubgcp6 C A 15: 89,004,728 (GRCm39) W297L probably damaging Het
Twist1 T C 12: 34,008,355 (GRCm39) S127P probably damaging Het
Ubr4 T C 4: 139,179,966 (GRCm39) I247T unknown Het
Ubr5 G A 15: 37,988,481 (GRCm39) T2153M Het
Utrn A G 10: 12,573,833 (GRCm39) V1079A probably benign Het
Vcan T C 13: 89,852,237 (GRCm39) T908A probably damaging Het
Vmn2r104 A G 17: 20,249,791 (GRCm39) F827L probably damaging Het
Vmn2r111 T A 17: 22,767,380 (GRCm39) T706S probably benign Het
Vmn2r114 T C 17: 23,527,035 (GRCm39) D499G probably null Het
Vmn2r92 T C 17: 18,391,533 (GRCm39) S512P probably damaging Het
Vps4b A T 1: 106,708,232 (GRCm39) probably null Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Wnt10b T C 15: 98,672,045 (GRCm39) Q224R probably benign Het
Ylpm1 C T 12: 85,077,268 (GRCm39) P1331L possibly damaging Het
Zfhx4 G A 3: 5,307,267 (GRCm39) M164I possibly damaging Het
Zfp51 A G 17: 21,683,762 (GRCm39) T126A probably benign Het
Zfp609 A G 9: 65,613,418 (GRCm39) V339A probably benign Het
Zfp687 C T 3: 94,914,841 (GRCm39) R1220H probably damaging Het
Zfyve21 C T 12: 111,790,249 (GRCm39) L84F probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0090:Nup210l UTSW 3 90,119,086 (GRCm39) missense probably benign 0.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1858:Nup210l UTSW 3 90,061,806 (GRCm39) missense probably damaging 0.97
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5004:Nup210l UTSW 3 90,087,472 (GRCm39) nonsense probably null
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7840:Nup210l UTSW 3 90,030,036 (GRCm39) missense probably benign 0.08
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8084:Nup210l UTSW 3 90,043,365 (GRCm39) missense probably benign 0.15
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8770:Nup210l UTSW 3 90,025,850 (GRCm39) missense probably damaging 1.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9381:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9682:Nup210l UTSW 3 90,051,469 (GRCm39) missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TATGCTAGGATTACAGATGCATGC -3'
(R):5'- AGTCAGAAGTATACACATGCCG -3'

Sequencing Primer
(F):5'- CAGATGCATGCCAATATTCTTAAGC -3'
(R):5'- GAGAACCCCTGTCTCAAA -3'
Posted On 2019-10-17