Incidental Mutation 'R7514:Utrn'
ID582320
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Nameutrophin
SynonymsG-utrophin, DRP, Dmdl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7514 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location12382188-12869365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12698089 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1079 (V1079A)
Ref Sequence ENSEMBL: ENSMUSP00000076093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]
Predicted Effect probably benign
Transcript: ENSMUST00000076817
AA Change: V1079A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: V1079A

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218635
AA Change: V1079A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,802 L261P probably damaging Het
A4gnt A G 9: 99,620,545 I253V probably benign Het
Acap2 A T 16: 31,154,567 probably null Het
Adora2b G T 11: 62,265,320 M198I probably damaging Het
Akap5 C A 12: 76,328,529 T245K probably benign Het
Aldh1a2 T C 9: 71,284,963 I399T probably damaging Het
Ank2 G A 3: 127,025,603 S473L probably benign Het
Anln A T 9: 22,360,857 D655E probably damaging Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
Arid1b A G 17: 5,341,714 K1787E probably benign Het
Art4 T C 6: 136,854,741 H134R probably benign Het
Borcs6 G A 11: 69,060,584 V263M probably damaging Het
C8a A T 4: 104,846,050 M314K possibly damaging Het
Cbfa2t3 T G 8: 122,635,126 M386L probably damaging Het
Ccdc170 T A 10: 4,546,839 V459E probably benign Het
Cdh4 T A 2: 179,890,843 N699K possibly damaging Het
Cdk12 T C 11: 98,222,658 L756P unknown Het
Chsy1 A G 7: 66,172,120 D701G probably damaging Het
Cnot9 A G 1: 74,528,762 T270A probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyb5r1 A G 1: 134,410,530 E228G probably damaging Het
D630003M21Rik A G 2: 158,217,353 L209P probably damaging Het
Dennd2c T A 3: 103,163,062 D791E probably benign Het
Dnah14 T C 1: 181,628,067 I919T probably damaging Het
Dpp8 T C 9: 65,078,754 L842S probably damaging Het
Ern1 A G 11: 106,409,893 probably null Het
Exo1 T C 1: 175,906,666 probably null Het
Fam161b T G 12: 84,357,738 E56A possibly damaging Het
Fbrsl1 T C 5: 110,432,933 T153A probably benign Het
Fcgr3 T G 1: 171,059,343 D4A probably benign Het
Gltp C T 5: 114,670,460 A193T probably benign Het
Gm10031 A G 1: 156,524,754 D175G probably benign Het
Gm13178 A T 4: 144,703,228 V397D possibly damaging Het
Gm3159 A T 14: 4,399,690 S142C probably damaging Het
Gphn T C 12: 78,626,165 V485A probably damaging Het
Grik2 A T 10: 49,523,808 N275K probably damaging Het
Gstt3 G T 10: 75,776,791 Q102K probably damaging Het
Hivep3 T A 4: 120,096,855 F789L possibly damaging Het
Ing5 A G 1: 93,816,442 N157D possibly damaging Het
Itga3 C T 11: 95,065,896 W177* probably null Het
Jag2 T C 12: 112,929,052 T83A probably benign Het
Krt90 G A 15: 101,553,170 T532I unknown Het
Lcn2 A G 2: 32,387,849 probably null Het
Lrig2 A G 3: 104,465,760 S602P probably damaging Het
Lsm1 A C 8: 25,792,209 R33S probably damaging Het
Mast4 A T 13: 102,787,426 Y492* probably null Het
Mcm3 A T 1: 20,805,896 L658Q probably benign Het
Myh4 G A 11: 67,243,322 probably null Het
Nck2 T C 1: 43,569,221 V341A probably benign Het
Nucb1 T C 7: 45,501,718 probably null Het
Nup210l G C 3: 90,210,459 probably null Het
Olfr1039 A T 2: 86,131,628 F12I probably damaging Het
Olfr3 A G 2: 36,812,639 I151T probably benign Het
Olfr837 A T 9: 19,137,865 S291C possibly damaging Het
Olfr912 T A 9: 38,582,051 M258K probably damaging Het
Olfr921 G A 9: 38,775,678 C141Y probably damaging Het
Pla2g4a G A 1: 149,851,362 P556S probably damaging Het
Plat T C 8: 22,775,642 C234R probably damaging Het
Ppfia1 T C 7: 144,517,713 I321V probably benign Het
Prrc1 T A 18: 57,363,253 V92E probably benign Het
Prss3 A G 6: 41,373,914 V214A probably damaging Het
Ptprg G T 14: 12,179,342 K786N possibly damaging Het
Rabgap1 G T 2: 37,537,342 G645V probably damaging Het
Rfx4 T C 10: 84,880,226 S470P probably damaging Het
Rin3 C T 12: 102,369,650 Q607* probably null Het
Sema3a A G 5: 13,523,126 H207R probably benign Het
Serpinb12 G A 1: 106,950,804 E181K probably damaging Het
Serpinb6c G A 13: 33,897,403 Q88* probably null Het
Shmt1 A C 11: 60,801,986 C90W probably damaging Het
Slc16a13 C T 11: 70,218,884 V264M probably damaging Het
Slc17a8 G T 10: 89,592,107 P286Q probably damaging Het
Slc27a6 C T 18: 58,612,221 Q576* probably null Het
Slc30a9 T C 5: 67,348,078 S470P possibly damaging Het
Slc44a2 G T 9: 21,342,472 K136N possibly damaging Het
Smarca5 A T 8: 80,717,534 H534Q probably damaging Het
Son T G 16: 91,654,860 L165R probably damaging Het
Sox10 G A 15: 79,156,221 P373L probably benign Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Srrm4 A G 5: 116,446,511 L500P probably damaging Het
Tap1 T C 17: 34,196,665 L689P probably damaging Het
Tfg A G 16: 56,705,609 probably null Het
Tjp2 C T 19: 24,111,522 V677I probably benign Het
Tmprss11g T G 5: 86,497,317 D85A probably damaging Het
Tnfsf9 T C 17: 57,107,238 S222P probably damaging Het
Trank1 A G 9: 111,364,756 N616S probably damaging Het
Tubgcp6 C A 15: 89,120,525 W297L probably damaging Het
Twist1 T C 12: 33,958,356 S127P probably damaging Het
Ubr4 T C 4: 139,452,655 I247T unknown Het
Ubr5 G A 15: 37,988,237 T2153M Het
Vcan T C 13: 89,704,118 T908A probably damaging Het
Vmn2r104 A G 17: 20,029,529 F827L probably damaging Het
Vmn2r111 T A 17: 22,548,399 T706S probably benign Het
Vmn2r114 T C 17: 23,308,061 D499G probably null Het
Vmn2r92 T C 17: 18,171,271 S512P probably damaging Het
Vps4b A T 1: 106,780,502 probably null Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt10b T C 15: 98,774,164 Q224R probably benign Het
Ylpm1 C T 12: 85,030,494 P1331L possibly damaging Het
Zfhx4 G A 3: 5,242,207 M164I possibly damaging Het
Zfp51 A G 17: 21,463,500 T126A probably benign Het
Zfp609 A G 9: 65,706,136 V339A probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Zfyve21 C T 12: 111,823,815 L84F probably damaging Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12666704 missense probably benign 0.06
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0219:Utrn UTSW 10 12684451 missense probably damaging 1.00
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1445:Utrn UTSW 10 12678574 splice site probably benign
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1585:Utrn UTSW 10 12436285 missense possibly damaging 0.62
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1778:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1818:Utrn UTSW 10 12709964 critical splice donor site probably null
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4782:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6919:Utrn UTSW 10 12693470 nonsense probably null
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
R7037:Utrn UTSW 10 12826770 splice site probably null
R7038:Utrn UTSW 10 12682338 missense probably damaging 1.00
R7055:Utrn UTSW 10 12747921 missense probably benign 0.23
R7072:Utrn UTSW 10 12465213 missense probably damaging 1.00
R7090:Utrn UTSW 10 12684516 missense possibly damaging 0.58
R7211:Utrn UTSW 10 12401335 missense possibly damaging 0.72
R7248:Utrn UTSW 10 12728818 missense possibly damaging 0.51
R7305:Utrn UTSW 10 12385536 missense probably benign
R7334:Utrn UTSW 10 12728009 intron probably null
R7348:Utrn UTSW 10 12748018 missense probably damaging 1.00
R7375:Utrn UTSW 10 12641020 missense probably damaging 1.00
R7436:Utrn UTSW 10 12439791 missense possibly damaging 0.72
R7476:Utrn UTSW 10 12640951 missense probably benign
R7527:Utrn UTSW 10 12401382 missense possibly damaging 0.81
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAAGCAGTAGTCTTCCTT -3'
(R):5'- GAATCCTGAATACCAGTCACTATGTC -3'

Sequencing Primer
(F):5'- GCTGTCCTGTAAAAATTGTAGAGCAC -3'
(R):5'- CCTTGAAATATTTGCAGGATCCAGG -3'
Posted On2019-10-17