Incidental Mutation 'R7514:Slc16a13'
ID582329
Institutional Source Beutler Lab
Gene Symbol Slc16a13
Ensembl Gene ENSMUSG00000044367
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 13
Synonyms1700007D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R7514 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70216789-70221064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70218884 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 264 (V264M)
Ref Sequence ENSEMBL: ENSMUSP00000053218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060010] [ENSMUST00000094055] [ENSMUST00000123716] [ENSMUST00000126296] [ENSMUST00000126388] [ENSMUST00000136328] [ENSMUST00000141290] [ENSMUST00000153993] [ENSMUST00000159867] [ENSMUST00000171032] [ENSMUST00000190533]
Predicted Effect probably damaging
Transcript: ENSMUST00000060010
AA Change: V264M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053218
Gene: ENSMUSG00000044367
AA Change: V264M

DomainStartEndE-ValueType
Pfam:MFS_1 14 277 1.7e-22 PFAM
Pfam:MFS_1 219 423 6.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094055
SMART Domains Protein: ENSMUSP00000091597
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123716
SMART Domains Protein: ENSMUSP00000114871
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126296
SMART Domains Protein: ENSMUSP00000118381
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 16 196 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126388
SMART Domains Protein: ENSMUSP00000116648
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 340 5.5e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136328
SMART Domains Protein: ENSMUSP00000115212
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:MFS_1 66 297 8.3e-10 PFAM
low complexity region 306 324 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141290
SMART Domains Protein: ENSMUSP00000116316
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153993
SMART Domains Protein: ENSMUSP00000122586
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 56 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159867
SMART Domains Protein: ENSMUSP00000124687
Gene: ENSMUSG00000044367

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171032
SMART Domains Protein: ENSMUSP00000128419
Gene: ENSMUSG00000040938

DomainStartEndE-ValueType
Pfam:MFS_1 17 316 1.8e-24 PFAM
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
low complexity region 407 420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190533
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,802 L261P probably damaging Het
A4gnt A G 9: 99,620,545 I253V probably benign Het
Acap2 A T 16: 31,154,567 probably null Het
Adora2b G T 11: 62,265,320 M198I probably damaging Het
Akap5 C A 12: 76,328,529 T245K probably benign Het
Aldh1a2 T C 9: 71,284,963 I399T probably damaging Het
Ank2 G A 3: 127,025,603 S473L probably benign Het
Anln A T 9: 22,360,857 D655E probably damaging Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
Arid1b A G 17: 5,341,714 K1787E probably benign Het
Art4 T C 6: 136,854,741 H134R probably benign Het
Borcs6 G A 11: 69,060,584 V263M probably damaging Het
C8a A T 4: 104,846,050 M314K possibly damaging Het
Cbfa2t3 T G 8: 122,635,126 M386L probably damaging Het
Ccdc170 T A 10: 4,546,839 V459E probably benign Het
Cdh4 T A 2: 179,890,843 N699K possibly damaging Het
Cdk12 T C 11: 98,222,658 L756P unknown Het
Chsy1 A G 7: 66,172,120 D701G probably damaging Het
Cnot9 A G 1: 74,528,762 T270A probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyb5r1 A G 1: 134,410,530 E228G probably damaging Het
D630003M21Rik A G 2: 158,217,353 L209P probably damaging Het
Dennd2c T A 3: 103,163,062 D791E probably benign Het
Dnah14 T C 1: 181,628,067 I919T probably damaging Het
Dpp8 T C 9: 65,078,754 L842S probably damaging Het
Ern1 A G 11: 106,409,893 probably null Het
Exo1 T C 1: 175,906,666 probably null Het
Fam161b T G 12: 84,357,738 E56A possibly damaging Het
Fbrsl1 T C 5: 110,432,933 T153A probably benign Het
Fcgr3 T G 1: 171,059,343 D4A probably benign Het
Gltp C T 5: 114,670,460 A193T probably benign Het
Gm10031 A G 1: 156,524,754 D175G probably benign Het
Gm13178 A T 4: 144,703,228 V397D possibly damaging Het
Gm3159 A T 14: 4,399,690 S142C probably damaging Het
Gphn T C 12: 78,626,165 V485A probably damaging Het
Grik2 A T 10: 49,523,808 N275K probably damaging Het
Gstt3 G T 10: 75,776,791 Q102K probably damaging Het
Hivep3 T A 4: 120,096,855 F789L possibly damaging Het
Ing5 A G 1: 93,816,442 N157D possibly damaging Het
Itga3 C T 11: 95,065,896 W177* probably null Het
Jag2 T C 12: 112,929,052 T83A probably benign Het
Krt90 G A 15: 101,553,170 T532I unknown Het
Lcn2 A G 2: 32,387,849 probably null Het
Lrig2 A G 3: 104,465,760 S602P probably damaging Het
Lsm1 A C 8: 25,792,209 R33S probably damaging Het
Mast4 A T 13: 102,787,426 Y492* probably null Het
Mcm3 A T 1: 20,805,896 L658Q probably benign Het
Myh4 G A 11: 67,243,322 probably null Het
Nck2 T C 1: 43,569,221 V341A probably benign Het
Nucb1 T C 7: 45,501,718 probably null Het
Nup210l G C 3: 90,210,459 probably null Het
Olfr1039 A T 2: 86,131,628 F12I probably damaging Het
Olfr3 A G 2: 36,812,639 I151T probably benign Het
Olfr837 A T 9: 19,137,865 S291C possibly damaging Het
Olfr912 T A 9: 38,582,051 M258K probably damaging Het
Olfr921 G A 9: 38,775,678 C141Y probably damaging Het
Pla2g4a G A 1: 149,851,362 P556S probably damaging Het
Plat T C 8: 22,775,642 C234R probably damaging Het
Ppfia1 T C 7: 144,517,713 I321V probably benign Het
Prrc1 T A 18: 57,363,253 V92E probably benign Het
Prss3 A G 6: 41,373,914 V214A probably damaging Het
Ptprg G T 14: 12,179,342 K786N possibly damaging Het
Rabgap1 G T 2: 37,537,342 G645V probably damaging Het
Rfx4 T C 10: 84,880,226 S470P probably damaging Het
Rin3 C T 12: 102,369,650 Q607* probably null Het
Sema3a A G 5: 13,523,126 H207R probably benign Het
Serpinb12 G A 1: 106,950,804 E181K probably damaging Het
Serpinb6c G A 13: 33,897,403 Q88* probably null Het
Shmt1 A C 11: 60,801,986 C90W probably damaging Het
Slc17a8 G T 10: 89,592,107 P286Q probably damaging Het
Slc27a6 C T 18: 58,612,221 Q576* probably null Het
Slc30a9 T C 5: 67,348,078 S470P possibly damaging Het
Slc44a2 G T 9: 21,342,472 K136N possibly damaging Het
Smarca5 A T 8: 80,717,534 H534Q probably damaging Het
Son T G 16: 91,654,860 L165R probably damaging Het
Sox10 G A 15: 79,156,221 P373L probably benign Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Srrm4 A G 5: 116,446,511 L500P probably damaging Het
Tap1 T C 17: 34,196,665 L689P probably damaging Het
Tfg A G 16: 56,705,609 probably null Het
Tjp2 C T 19: 24,111,522 V677I probably benign Het
Tmprss11g T G 5: 86,497,317 D85A probably damaging Het
Tnfsf9 T C 17: 57,107,238 S222P probably damaging Het
Trank1 A G 9: 111,364,756 N616S probably damaging Het
Tubgcp6 C A 15: 89,120,525 W297L probably damaging Het
Twist1 T C 12: 33,958,356 S127P probably damaging Het
Ubr4 T C 4: 139,452,655 I247T unknown Het
Ubr5 G A 15: 37,988,237 T2153M Het
Utrn A G 10: 12,698,089 V1079A probably benign Het
Vcan T C 13: 89,704,118 T908A probably damaging Het
Vmn2r104 A G 17: 20,029,529 F827L probably damaging Het
Vmn2r111 T A 17: 22,548,399 T706S probably benign Het
Vmn2r114 T C 17: 23,308,061 D499G probably null Het
Vmn2r92 T C 17: 18,171,271 S512P probably damaging Het
Vps4b A T 1: 106,780,502 probably null Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt10b T C 15: 98,774,164 Q224R probably benign Het
Ylpm1 C T 12: 85,030,494 P1331L possibly damaging Het
Zfhx4 G A 3: 5,242,207 M164I possibly damaging Het
Zfp51 A G 17: 21,463,500 T126A probably benign Het
Zfp609 A G 9: 65,706,136 V339A probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Zfyve21 C T 12: 111,823,815 L84F probably damaging Het
Other mutations in Slc16a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Slc16a13 APN 11 70220514 missense probably damaging 0.99
R0729:Slc16a13 UTSW 11 70219031 missense probably damaging 1.00
R0792:Slc16a13 UTSW 11 70220631 missense probably damaging 1.00
R1086:Slc16a13 UTSW 11 70219024 missense probably damaging 1.00
R1588:Slc16a13 UTSW 11 70218595 nonsense probably null
R1593:Slc16a13 UTSW 11 70219082 missense probably benign 0.04
R4329:Slc16a13 UTSW 11 70217897 missense probably benign 0.03
R4688:Slc16a13 UTSW 11 70220275 missense probably damaging 0.98
R6846:Slc16a13 UTSW 11 70217835 missense probably benign 0.35
R7380:Slc16a13 UTSW 11 70219279 missense probably damaging 1.00
R7390:Slc16a13 UTSW 11 70218971 missense probably benign 0.03
R7807:Slc16a13 UTSW 11 70220562 missense probably damaging 0.97
R7888:Slc16a13 UTSW 11 70218980 missense possibly damaging 0.79
R7971:Slc16a13 UTSW 11 70218980 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCTCCTGATGTGAAACCATAGG -3'
(R):5'- TCACTACACCTGATGGCCTGTG -3'

Sequencing Primer
(F):5'- CTGATGTGAAACCATAGGCCACAG -3'
(R):5'- ACTGAAGACGCTGCTGTG -3'
Posted On2019-10-17