Incidental Mutation 'R7514:Gphn'
ID582336
Institutional Source Beutler Lab
Gene Symbol Gphn
Ensembl Gene ENSMUSG00000047454
Gene Namegephyrin
Synonyms5730552E08Rik, geph
Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7514 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location78226379-78684772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78626165 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 485 (V485A)
Ref Sequence ENSEMBL: ENSMUSP00000106018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]
Predicted Effect probably benign
Transcript: ENSMUST00000052472
AA Change: V482A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454
AA Change: V482A

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 356 522 5.6e-53 PFAM
MoCF_biosynth 535 678 8.1e-38 SMART
Pfam:MoeA_C 691 766 8.9e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110388
AA Change: V485A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454
AA Change: V485A

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 360 525 2.1e-35 PFAM
MoCF_biosynth 538 681 8.1e-38 SMART
Pfam:MoeA_C 694 769 8.1e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,802 L261P probably damaging Het
A4gnt A G 9: 99,620,545 I253V probably benign Het
Acap2 A T 16: 31,154,567 probably null Het
Adora2b G T 11: 62,265,320 M198I probably damaging Het
Akap5 C A 12: 76,328,529 T245K probably benign Het
Aldh1a2 T C 9: 71,284,963 I399T probably damaging Het
Ank2 G A 3: 127,025,603 S473L probably benign Het
Anln A T 9: 22,360,857 D655E probably damaging Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
Arid1b A G 17: 5,341,714 K1787E probably benign Het
Art4 T C 6: 136,854,741 H134R probably benign Het
Borcs6 G A 11: 69,060,584 V263M probably damaging Het
C8a A T 4: 104,846,050 M314K possibly damaging Het
Cbfa2t3 T G 8: 122,635,126 M386L probably damaging Het
Ccdc170 T A 10: 4,546,839 V459E probably benign Het
Cdh4 T A 2: 179,890,843 N699K possibly damaging Het
Cdk12 T C 11: 98,222,658 L756P unknown Het
Chsy1 A G 7: 66,172,120 D701G probably damaging Het
Cnot9 A G 1: 74,528,762 T270A probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyb5r1 A G 1: 134,410,530 E228G probably damaging Het
D630003M21Rik A G 2: 158,217,353 L209P probably damaging Het
Dennd2c T A 3: 103,163,062 D791E probably benign Het
Dnah14 T C 1: 181,628,067 I919T probably damaging Het
Dpp8 T C 9: 65,078,754 L842S probably damaging Het
Ern1 A G 11: 106,409,893 probably null Het
Exo1 T C 1: 175,906,666 probably null Het
Fam161b T G 12: 84,357,738 E56A possibly damaging Het
Fbrsl1 T C 5: 110,432,933 T153A probably benign Het
Fcgr3 T G 1: 171,059,343 D4A probably benign Het
Gltp C T 5: 114,670,460 A193T probably benign Het
Gm10031 A G 1: 156,524,754 D175G probably benign Het
Gm13178 A T 4: 144,703,228 V397D possibly damaging Het
Gm3159 A T 14: 4,399,690 S142C probably damaging Het
Grik2 A T 10: 49,523,808 N275K probably damaging Het
Gstt3 G T 10: 75,776,791 Q102K probably damaging Het
Hivep3 T A 4: 120,096,855 F789L possibly damaging Het
Ing5 A G 1: 93,816,442 N157D possibly damaging Het
Itga3 C T 11: 95,065,896 W177* probably null Het
Jag2 T C 12: 112,929,052 T83A probably benign Het
Krt90 G A 15: 101,553,170 T532I unknown Het
Lcn2 A G 2: 32,387,849 probably null Het
Lrig2 A G 3: 104,465,760 S602P probably damaging Het
Lsm1 A C 8: 25,792,209 R33S probably damaging Het
Mast4 A T 13: 102,787,426 Y492* probably null Het
Mcm3 A T 1: 20,805,896 L658Q probably benign Het
Myh4 G A 11: 67,243,322 probably null Het
Nck2 T C 1: 43,569,221 V341A probably benign Het
Nucb1 T C 7: 45,501,718 probably null Het
Nup210l G C 3: 90,210,459 probably null Het
Olfr1039 A T 2: 86,131,628 F12I probably damaging Het
Olfr3 A G 2: 36,812,639 I151T probably benign Het
Olfr837 A T 9: 19,137,865 S291C possibly damaging Het
Olfr912 T A 9: 38,582,051 M258K probably damaging Het
Olfr921 G A 9: 38,775,678 C141Y probably damaging Het
Pla2g4a G A 1: 149,851,362 P556S probably damaging Het
Plat T C 8: 22,775,642 C234R probably damaging Het
Ppfia1 T C 7: 144,517,713 I321V probably benign Het
Prrc1 T A 18: 57,363,253 V92E probably benign Het
Prss3 A G 6: 41,373,914 V214A probably damaging Het
Ptprg G T 14: 12,179,342 K786N possibly damaging Het
Rabgap1 G T 2: 37,537,342 G645V probably damaging Het
Rfx4 T C 10: 84,880,226 S470P probably damaging Het
Rin3 C T 12: 102,369,650 Q607* probably null Het
Sema3a A G 5: 13,523,126 H207R probably benign Het
Serpinb12 G A 1: 106,950,804 E181K probably damaging Het
Serpinb6c G A 13: 33,897,403 Q88* probably null Het
Shmt1 A C 11: 60,801,986 C90W probably damaging Het
Slc16a13 C T 11: 70,218,884 V264M probably damaging Het
Slc17a8 G T 10: 89,592,107 P286Q probably damaging Het
Slc27a6 C T 18: 58,612,221 Q576* probably null Het
Slc30a9 T C 5: 67,348,078 S470P possibly damaging Het
Slc44a2 G T 9: 21,342,472 K136N possibly damaging Het
Smarca5 A T 8: 80,717,534 H534Q probably damaging Het
Son T G 16: 91,654,860 L165R probably damaging Het
Sox10 G A 15: 79,156,221 P373L probably benign Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Srrm4 A G 5: 116,446,511 L500P probably damaging Het
Tap1 T C 17: 34,196,665 L689P probably damaging Het
Tfg A G 16: 56,705,609 probably null Het
Tjp2 C T 19: 24,111,522 V677I probably benign Het
Tmprss11g T G 5: 86,497,317 D85A probably damaging Het
Tnfsf9 T C 17: 57,107,238 S222P probably damaging Het
Trank1 A G 9: 111,364,756 N616S probably damaging Het
Tubgcp6 C A 15: 89,120,525 W297L probably damaging Het
Twist1 T C 12: 33,958,356 S127P probably damaging Het
Ubr4 T C 4: 139,452,655 I247T unknown Het
Ubr5 G A 15: 37,988,237 T2153M Het
Utrn A G 10: 12,698,089 V1079A probably benign Het
Vcan T C 13: 89,704,118 T908A probably damaging Het
Vmn2r104 A G 17: 20,029,529 F827L probably damaging Het
Vmn2r111 T A 17: 22,548,399 T706S probably benign Het
Vmn2r114 T C 17: 23,308,061 D499G probably null Het
Vmn2r92 T C 17: 18,171,271 S512P probably damaging Het
Vps4b A T 1: 106,780,502 probably null Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt10b T C 15: 98,774,164 Q224R probably benign Het
Ylpm1 C T 12: 85,030,494 P1331L possibly damaging Het
Zfhx4 G A 3: 5,242,207 M164I possibly damaging Het
Zfp51 A G 17: 21,463,500 T126A probably benign Het
Zfp609 A G 9: 65,706,136 V339A probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Zfyve21 C T 12: 111,823,815 L84F probably damaging Het
Other mutations in Gphn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gphn APN 12 78504632 missense probably damaging 1.00
IGL00701:Gphn APN 12 78626167 missense possibly damaging 0.93
IGL00844:Gphn APN 12 78664568 splice site probably benign
IGL01517:Gphn APN 12 78376374 missense probably damaging 1.00
IGL02499:Gphn APN 12 78492300 missense probably benign 0.17
IGL02827:Gphn APN 12 78609220 missense probably damaging 1.00
IGL03136:Gphn APN 12 78481333 missense possibly damaging 0.69
IGL03348:Gphn APN 12 78627119 missense probably damaging 0.99
IGL03382:Gphn APN 12 78481313 missense probably damaging 1.00
grizzlies UTSW 12 78654880 missense probably benign 0.28
3-1:Gphn UTSW 12 78613001 missense probably benign 0.06
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0212:Gphn UTSW 12 78637552 missense probably damaging 0.99
R0389:Gphn UTSW 12 78590659 missense probably damaging 1.00
R0535:Gphn UTSW 12 78492050 missense possibly damaging 0.90
R1464:Gphn UTSW 12 78612964 splice site probably benign
R1503:Gphn UTSW 12 78504629 missense possibly damaging 0.94
R1606:Gphn UTSW 12 78683883 missense probably damaging 1.00
R1896:Gphn UTSW 12 78412354 missense possibly damaging 0.74
R2248:Gphn UTSW 12 78454821 missense probably damaging 1.00
R3708:Gphn UTSW 12 78532693 missense probably benign
R3907:Gphn UTSW 12 78493942 splice site probably benign
R4537:Gphn UTSW 12 78494014 missense probably benign 0.03
R4667:Gphn UTSW 12 78454817 missense probably damaging 1.00
R4808:Gphn UTSW 12 78654880 missense probably benign 0.28
R4840:Gphn UTSW 12 78522955 critical splice donor site probably null
R4852:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4854:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4855:Gphn UTSW 12 78627210 missense probably damaging 1.00
R5083:Gphn UTSW 12 78623289 splice site probably null
R5224:Gphn UTSW 12 78590587 missense probably damaging 0.99
R5580:Gphn UTSW 12 78492044 missense probably damaging 1.00
R5626:Gphn UTSW 12 78683897 missense probably benign 0.11
R6270:Gphn UTSW 12 78522950 missense probably benign
R6563:Gphn UTSW 12 78680396 critical splice donor site probably null
R6943:Gphn UTSW 12 78492181 missense possibly damaging 0.88
R6958:Gphn UTSW 12 78680299 missense possibly damaging 0.86
R7170:Gphn UTSW 12 78683889 missense possibly damaging 0.67
R7295:Gphn UTSW 12 78492102 missense probably benign 0.02
R7537:Gphn UTSW 12 78504680 missense possibly damaging 0.62
R7680:Gphn UTSW 12 78412374 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGCAAAGAGTTAGCAAATGGTTTTG -3'
(R):5'- CAGTAATTTTGGACTGGCTAGAAG -3'

Sequencing Primer
(F):5'- ATATGGGCCTGTCTGATG -3'
(R):5'- AAAACTCTACCCTTTTCTCATGTTGG -3'
Posted On2019-10-17