Incidental Mutation 'R7514:Ylpm1'
ID582338
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene NameYLP motif containing 1
SynonymsZAP, A930013E17Rik, Zap3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7514 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location84996321-85070515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85030494 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1331 (P1331L)
Ref Sequence ENSEMBL: ENSMUSP00000021670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021670
AA Change: P1331L

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244
AA Change: P1331L

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101202
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164558
AA Change: P873L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244
AA Change: P873L

DomainStartEndE-ValueType
low complexity region 80 196 N/A INTRINSIC
low complexity region 230 238 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 508 514 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
coiled coil region 989 1016 N/A INTRINSIC
low complexity region 1036 1059 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1078 1099 N/A INTRINSIC
low complexity region 1140 1172 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
low complexity region 1262 1278 N/A INTRINSIC
low complexity region 1339 1350 N/A INTRINSIC
Pfam:AAA_33 1371 1559 5.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168977
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,802 L261P probably damaging Het
A4gnt A G 9: 99,620,545 I253V probably benign Het
Acap2 A T 16: 31,154,567 probably null Het
Adora2b G T 11: 62,265,320 M198I probably damaging Het
Akap5 C A 12: 76,328,529 T245K probably benign Het
Aldh1a2 T C 9: 71,284,963 I399T probably damaging Het
Ank2 G A 3: 127,025,603 S473L probably benign Het
Anln A T 9: 22,360,857 D655E probably damaging Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
Arid1b A G 17: 5,341,714 K1787E probably benign Het
Art4 T C 6: 136,854,741 H134R probably benign Het
Borcs6 G A 11: 69,060,584 V263M probably damaging Het
C8a A T 4: 104,846,050 M314K possibly damaging Het
Cbfa2t3 T G 8: 122,635,126 M386L probably damaging Het
Ccdc170 T A 10: 4,546,839 V459E probably benign Het
Cdh4 T A 2: 179,890,843 N699K possibly damaging Het
Cdk12 T C 11: 98,222,658 L756P unknown Het
Chsy1 A G 7: 66,172,120 D701G probably damaging Het
Cnot9 A G 1: 74,528,762 T270A probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyb5r1 A G 1: 134,410,530 E228G probably damaging Het
D630003M21Rik A G 2: 158,217,353 L209P probably damaging Het
Dennd2c T A 3: 103,163,062 D791E probably benign Het
Dnah14 T C 1: 181,628,067 I919T probably damaging Het
Dpp8 T C 9: 65,078,754 L842S probably damaging Het
Ern1 A G 11: 106,409,893 probably null Het
Exo1 T C 1: 175,906,666 probably null Het
Fam161b T G 12: 84,357,738 E56A possibly damaging Het
Fbrsl1 T C 5: 110,432,933 T153A probably benign Het
Fcgr3 T G 1: 171,059,343 D4A probably benign Het
Gltp C T 5: 114,670,460 A193T probably benign Het
Gm10031 A G 1: 156,524,754 D175G probably benign Het
Gm13178 A T 4: 144,703,228 V397D possibly damaging Het
Gm3159 A T 14: 4,399,690 S142C probably damaging Het
Gphn T C 12: 78,626,165 V485A probably damaging Het
Grik2 A T 10: 49,523,808 N275K probably damaging Het
Gstt3 G T 10: 75,776,791 Q102K probably damaging Het
Hivep3 T A 4: 120,096,855 F789L possibly damaging Het
Ing5 A G 1: 93,816,442 N157D possibly damaging Het
Itga3 C T 11: 95,065,896 W177* probably null Het
Jag2 T C 12: 112,929,052 T83A probably benign Het
Krt90 G A 15: 101,553,170 T532I unknown Het
Lcn2 A G 2: 32,387,849 probably null Het
Lrig2 A G 3: 104,465,760 S602P probably damaging Het
Lsm1 A C 8: 25,792,209 R33S probably damaging Het
Mast4 A T 13: 102,787,426 Y492* probably null Het
Mcm3 A T 1: 20,805,896 L658Q probably benign Het
Myh4 G A 11: 67,243,322 probably null Het
Nck2 T C 1: 43,569,221 V341A probably benign Het
Nucb1 T C 7: 45,501,718 probably null Het
Nup210l G C 3: 90,210,459 probably null Het
Olfr1039 A T 2: 86,131,628 F12I probably damaging Het
Olfr3 A G 2: 36,812,639 I151T probably benign Het
Olfr837 A T 9: 19,137,865 S291C possibly damaging Het
Olfr912 T A 9: 38,582,051 M258K probably damaging Het
Olfr921 G A 9: 38,775,678 C141Y probably damaging Het
Pla2g4a G A 1: 149,851,362 P556S probably damaging Het
Plat T C 8: 22,775,642 C234R probably damaging Het
Ppfia1 T C 7: 144,517,713 I321V probably benign Het
Prrc1 T A 18: 57,363,253 V92E probably benign Het
Prss3 A G 6: 41,373,914 V214A probably damaging Het
Ptprg G T 14: 12,179,342 K786N possibly damaging Het
Rabgap1 G T 2: 37,537,342 G645V probably damaging Het
Rfx4 T C 10: 84,880,226 S470P probably damaging Het
Rin3 C T 12: 102,369,650 Q607* probably null Het
Sema3a A G 5: 13,523,126 H207R probably benign Het
Serpinb12 G A 1: 106,950,804 E181K probably damaging Het
Serpinb6c G A 13: 33,897,403 Q88* probably null Het
Shmt1 A C 11: 60,801,986 C90W probably damaging Het
Slc16a13 C T 11: 70,218,884 V264M probably damaging Het
Slc17a8 G T 10: 89,592,107 P286Q probably damaging Het
Slc27a6 C T 18: 58,612,221 Q576* probably null Het
Slc30a9 T C 5: 67,348,078 S470P possibly damaging Het
Slc44a2 G T 9: 21,342,472 K136N possibly damaging Het
Smarca5 A T 8: 80,717,534 H534Q probably damaging Het
Son T G 16: 91,654,860 L165R probably damaging Het
Sox10 G A 15: 79,156,221 P373L probably benign Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Srrm4 A G 5: 116,446,511 L500P probably damaging Het
Tap1 T C 17: 34,196,665 L689P probably damaging Het
Tfg A G 16: 56,705,609 probably null Het
Tjp2 C T 19: 24,111,522 V677I probably benign Het
Tmprss11g T G 5: 86,497,317 D85A probably damaging Het
Tnfsf9 T C 17: 57,107,238 S222P probably damaging Het
Trank1 A G 9: 111,364,756 N616S probably damaging Het
Tubgcp6 C A 15: 89,120,525 W297L probably damaging Het
Twist1 T C 12: 33,958,356 S127P probably damaging Het
Ubr4 T C 4: 139,452,655 I247T unknown Het
Ubr5 G A 15: 37,988,237 T2153M Het
Utrn A G 10: 12,698,089 V1079A probably benign Het
Vcan T C 13: 89,704,118 T908A probably damaging Het
Vmn2r104 A G 17: 20,029,529 F827L probably damaging Het
Vmn2r111 T A 17: 22,548,399 T706S probably benign Het
Vmn2r114 T C 17: 23,308,061 D499G probably null Het
Vmn2r92 T C 17: 18,171,271 S512P probably damaging Het
Vps4b A T 1: 106,780,502 probably null Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt10b T C 15: 98,774,164 Q224R probably benign Het
Zfhx4 G A 3: 5,242,207 M164I possibly damaging Het
Zfp51 A G 17: 21,463,500 T126A probably benign Het
Zfp609 A G 9: 65,706,136 V339A probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Zfyve21 C T 12: 111,823,815 L84F probably damaging Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
IGL02799:Ylpm1 UTSW 12 85044484 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0375:Ylpm1 UTSW 12 85014980 missense unknown
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4156:Ylpm1 UTSW 12 85057403 intron probably benign
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5605:Ylpm1 UTSW 12 85028853 missense probably damaging 1.00
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5748:Ylpm1 UTSW 12 85060251 splice site probably null
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6007:Ylpm1 UTSW 12 85029290 missense probably benign 0.33
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6305:Ylpm1 UTSW 12 85030545 missense probably damaging 1.00
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
R6794:Ylpm1 UTSW 12 84996881 missense unknown
R7383:Ylpm1 UTSW 12 85044468 missense possibly damaging 0.93
R7577:Ylpm1 UTSW 12 84997220 missense unknown
R7709:Ylpm1 UTSW 12 85013025 missense unknown
R7718:Ylpm1 UTSW 12 85029122 missense probably damaging 0.99
R7736:Ylpm1 UTSW 12 85012983 missense unknown
R7758:Ylpm1 UTSW 12 85015022 missense unknown
R7807:Ylpm1 UTSW 12 85014081 nonsense probably null
R7838:Ylpm1 UTSW 12 85048866 missense possibly damaging 0.90
R7846:Ylpm1 UTSW 12 85057268 missense probably damaging 0.98
R7921:Ylpm1 UTSW 12 85048866 missense possibly damaging 0.90
R7929:Ylpm1 UTSW 12 85057268 missense probably damaging 0.98
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Z1176:Ylpm1 UTSW 12 85030284 missense possibly damaging 0.93
Z1177:Ylpm1 UTSW 12 85057283 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCATCACGGTCTCATGATGG -3'
(R):5'- CCAGTCCATTCTGTCAGGAAC -3'

Sequencing Primer
(F):5'- ATCAGGATATGGATGAGGGTTATG -3'
(R):5'- TCTGTCAGGAACATAATCTCGC -3'
Posted On2019-10-17