Incidental Mutation 'R7514:Son'
ID582354
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene NameSon DNA binding protein
Synonyms2900011L12Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R7514 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location91647506-91679221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 91654860 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 165 (L165R)
Ref Sequence ENSEMBL: ENSMUSP00000109671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
Predicted Effect probably damaging
Transcript: ENSMUST00000114036
AA Change: L165R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: L165R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114037
AA Change: L165R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: L165R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117633
AA Change: L165R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: L165R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119368
AA Change: L165R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: L165R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140312
AA Change: L165R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: L165R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,195,802 L261P probably damaging Het
A4gnt A G 9: 99,620,545 I253V probably benign Het
Acap2 A T 16: 31,154,567 probably null Het
Adora2b G T 11: 62,265,320 M198I probably damaging Het
Akap5 C A 12: 76,328,529 T245K probably benign Het
Aldh1a2 T C 9: 71,284,963 I399T probably damaging Het
Ank2 G A 3: 127,025,603 S473L probably benign Het
Anln A T 9: 22,360,857 D655E probably damaging Het
Arhgef10 T C 8: 14,975,956 V820A probably benign Het
Arid1b A G 17: 5,341,714 K1787E probably benign Het
Art4 T C 6: 136,854,741 H134R probably benign Het
Borcs6 G A 11: 69,060,584 V263M probably damaging Het
C8a A T 4: 104,846,050 M314K possibly damaging Het
Cbfa2t3 T G 8: 122,635,126 M386L probably damaging Het
Ccdc170 T A 10: 4,546,839 V459E probably benign Het
Cdh4 T A 2: 179,890,843 N699K possibly damaging Het
Cdk12 T C 11: 98,222,658 L756P unknown Het
Chsy1 A G 7: 66,172,120 D701G probably damaging Het
Cnot9 A G 1: 74,528,762 T270A probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyb5r1 A G 1: 134,410,530 E228G probably damaging Het
D630003M21Rik A G 2: 158,217,353 L209P probably damaging Het
Dennd2c T A 3: 103,163,062 D791E probably benign Het
Dnah14 T C 1: 181,628,067 I919T probably damaging Het
Dpp8 T C 9: 65,078,754 L842S probably damaging Het
Ern1 A G 11: 106,409,893 probably null Het
Exo1 T C 1: 175,906,666 probably null Het
Fam161b T G 12: 84,357,738 E56A possibly damaging Het
Fbrsl1 T C 5: 110,432,933 T153A probably benign Het
Fcgr3 T G 1: 171,059,343 D4A probably benign Het
Gltp C T 5: 114,670,460 A193T probably benign Het
Gm10031 A G 1: 156,524,754 D175G probably benign Het
Gm13178 A T 4: 144,703,228 V397D possibly damaging Het
Gm3159 A T 14: 4,399,690 S142C probably damaging Het
Gphn T C 12: 78,626,165 V485A probably damaging Het
Grik2 A T 10: 49,523,808 N275K probably damaging Het
Gstt3 G T 10: 75,776,791 Q102K probably damaging Het
Hivep3 T A 4: 120,096,855 F789L possibly damaging Het
Ing5 A G 1: 93,816,442 N157D possibly damaging Het
Itga3 C T 11: 95,065,896 W177* probably null Het
Jag2 T C 12: 112,929,052 T83A probably benign Het
Krt90 G A 15: 101,553,170 T532I unknown Het
Lcn2 A G 2: 32,387,849 probably null Het
Lrig2 A G 3: 104,465,760 S602P probably damaging Het
Lsm1 A C 8: 25,792,209 R33S probably damaging Het
Mast4 A T 13: 102,787,426 Y492* probably null Het
Mcm3 A T 1: 20,805,896 L658Q probably benign Het
Myh4 G A 11: 67,243,322 probably null Het
Nck2 T C 1: 43,569,221 V341A probably benign Het
Nucb1 T C 7: 45,501,718 probably null Het
Nup210l G C 3: 90,210,459 probably null Het
Olfr1039 A T 2: 86,131,628 F12I probably damaging Het
Olfr3 A G 2: 36,812,639 I151T probably benign Het
Olfr837 A T 9: 19,137,865 S291C possibly damaging Het
Olfr912 T A 9: 38,582,051 M258K probably damaging Het
Olfr921 G A 9: 38,775,678 C141Y probably damaging Het
Pla2g4a G A 1: 149,851,362 P556S probably damaging Het
Plat T C 8: 22,775,642 C234R probably damaging Het
Ppfia1 T C 7: 144,517,713 I321V probably benign Het
Prrc1 T A 18: 57,363,253 V92E probably benign Het
Prss3 A G 6: 41,373,914 V214A probably damaging Het
Ptprg G T 14: 12,179,342 K786N possibly damaging Het
Rabgap1 G T 2: 37,537,342 G645V probably damaging Het
Rfx4 T C 10: 84,880,226 S470P probably damaging Het
Rin3 C T 12: 102,369,650 Q607* probably null Het
Sema3a A G 5: 13,523,126 H207R probably benign Het
Serpinb12 G A 1: 106,950,804 E181K probably damaging Het
Serpinb6c G A 13: 33,897,403 Q88* probably null Het
Shmt1 A C 11: 60,801,986 C90W probably damaging Het
Slc16a13 C T 11: 70,218,884 V264M probably damaging Het
Slc17a8 G T 10: 89,592,107 P286Q probably damaging Het
Slc27a6 C T 18: 58,612,221 Q576* probably null Het
Slc30a9 T C 5: 67,348,078 S470P possibly damaging Het
Slc44a2 G T 9: 21,342,472 K136N possibly damaging Het
Smarca5 A T 8: 80,717,534 H534Q probably damaging Het
Sox10 G A 15: 79,156,221 P373L probably benign Het
Sp100 C T 1: 85,681,139 R330* probably null Het
Srrm4 A G 5: 116,446,511 L500P probably damaging Het
Tap1 T C 17: 34,196,665 L689P probably damaging Het
Tfg A G 16: 56,705,609 probably null Het
Tjp2 C T 19: 24,111,522 V677I probably benign Het
Tmprss11g T G 5: 86,497,317 D85A probably damaging Het
Tnfsf9 T C 17: 57,107,238 S222P probably damaging Het
Trank1 A G 9: 111,364,756 N616S probably damaging Het
Tubgcp6 C A 15: 89,120,525 W297L probably damaging Het
Twist1 T C 12: 33,958,356 S127P probably damaging Het
Ubr4 T C 4: 139,452,655 I247T unknown Het
Ubr5 G A 15: 37,988,237 T2153M Het
Utrn A G 10: 12,698,089 V1079A probably benign Het
Vcan T C 13: 89,704,118 T908A probably damaging Het
Vmn2r104 A G 17: 20,029,529 F827L probably damaging Het
Vmn2r111 T A 17: 22,548,399 T706S probably benign Het
Vmn2r114 T C 17: 23,308,061 D499G probably null Het
Vmn2r92 T C 17: 18,171,271 S512P probably damaging Het
Vps4b A T 1: 106,780,502 probably null Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt10b T C 15: 98,774,164 Q224R probably benign Het
Ylpm1 C T 12: 85,030,494 P1331L possibly damaging Het
Zfhx4 G A 3: 5,242,207 M164I possibly damaging Het
Zfp51 A G 17: 21,463,500 T126A probably benign Het
Zfp609 A G 9: 65,706,136 V339A probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Zfyve21 C T 12: 111,823,815 L84F probably damaging Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91664322 missense probably damaging 0.99
IGL01024:Son APN 16 91655910 missense probably damaging 1.00
IGL01066:Son APN 16 91660136 intron probably benign
IGL01083:Son APN 16 91657391 missense probably damaging 1.00
IGL01115:Son APN 16 91659458 missense probably benign 0.31
IGL01467:Son APN 16 91657277 missense possibly damaging 0.93
IGL01506:Son APN 16 91657286 missense possibly damaging 0.67
IGL01933:Son APN 16 91658015 missense probably benign 0.00
IGL02156:Son APN 16 91656104 missense possibly damaging 0.93
IGL02473:Son APN 16 91658795 missense probably damaging 0.99
IGL02498:Son APN 16 91656825 missense probably damaging 0.99
IGL02517:Son APN 16 91655211 missense possibly damaging 0.92
IGL02530:Son APN 16 91658471 missense possibly damaging 0.50
IGL02865:Son APN 16 91651752 missense probably damaging 1.00
IGL03180:Son APN 16 91657008 missense probably damaging 1.00
R0013:Son UTSW 16 91651662 missense probably damaging 1.00
R0036:Son UTSW 16 91660166 intron probably benign
R0037:Son UTSW 16 91664728 missense probably damaging 1.00
R0041:Son UTSW 16 91659333 missense probably damaging 1.00
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0056:Son UTSW 16 91678155 missense possibly damaging 0.86
R0227:Son UTSW 16 91656873 missense probably damaging 0.99
R0256:Son UTSW 16 91656584 missense possibly damaging 0.95
R0302:Son UTSW 16 91656144 missense probably damaging 1.00
R0815:Son UTSW 16 91655484 missense probably damaging 0.98
R1225:Son UTSW 16 91657340 missense probably damaging 1.00
R1255:Son UTSW 16 91664695 missense probably damaging 1.00
R1457:Son UTSW 16 91657086 missense probably damaging 1.00
R1459:Son UTSW 16 91655342 missense possibly damaging 0.93
R1535:Son UTSW 16 91659734 missense probably damaging 0.99
R1587:Son UTSW 16 91659718 missense probably damaging 1.00
R1605:Son UTSW 16 91657664 missense probably damaging 1.00
R1629:Son UTSW 16 91657622 missense probably damaging 1.00
R1711:Son UTSW 16 91660226 intron probably benign
R2138:Son UTSW 16 91659372 missense possibly damaging 0.95
R2245:Son UTSW 16 91647960 unclassified probably null
R2351:Son UTSW 16 91657659 missense probably damaging 0.98
R2434:Son UTSW 16 91654687 missense probably damaging 1.00
R2870:Son UTSW 16 91664317 unclassified probably null
R2871:Son UTSW 16 91664317 unclassified probably null
R2872:Son UTSW 16 91664317 unclassified probably null
R2889:Son UTSW 16 91659899 unclassified probably benign
R3712:Son UTSW 16 91656726 missense probably damaging 0.99
R3913:Son UTSW 16 91660111 intron probably benign
R4172:Son UTSW 16 91659362 missense probably damaging 1.00
R4301:Son UTSW 16 91658411 missense possibly damaging 0.53
R4302:Son UTSW 16 91658411 missense possibly damaging 0.53
R4770:Son UTSW 16 91658868 missense probably damaging 0.96
R4881:Son UTSW 16 91675509 missense probably benign 0.31
R5020:Son UTSW 16 91656375 missense probably damaging 1.00
R5032:Son UTSW 16 91657664 missense probably damaging 1.00
R5151:Son UTSW 16 91655699 missense probably damaging 1.00
R5153:Son UTSW 16 91655022 missense possibly damaging 0.86
R5215:Son UTSW 16 91656675 missense probably damaging 0.99
R5243:Son UTSW 16 91654733 missense probably damaging 1.00
R5354:Son UTSW 16 91655739 missense probably damaging 0.99
R5529:Son UTSW 16 91655466 missense probably damaging 1.00
R5696:Son UTSW 16 91671413 missense possibly damaging 0.67
R5763:Son UTSW 16 91657490 missense probably damaging 1.00
R5766:Son UTSW 16 91664987 intron probably benign
R5788:Son UTSW 16 91660052 intron probably benign
R5992:Son UTSW 16 91658904 missense probably benign 0.04
R6314:Son UTSW 16 91660410 intron probably benign
R6371:Son UTSW 16 91674741
R6429:Son UTSW 16 91658166 missense probably benign 0.33
R6451:Son UTSW 16 91657602 missense probably damaging 0.99
R6489:Son UTSW 16 91655156 missense possibly damaging 0.70
R6513:Son UTSW 16 91659947 intron probably benign
R6753:Son UTSW 16 91657188 missense probably damaging 0.99
R6916:Son UTSW 16 91654785 missense probably damaging 0.97
R7070:Son UTSW 16 91656841 unclassified probably benign
R7079:Son UTSW 16 91656841 unclassified probably benign
R7110:Son UTSW 16 91656518 missense probably benign 0.01
R7120:Son UTSW 16 91656691 unclassified probably benign
R7120:Son UTSW 16 91670526 missense unknown
R7167:Son UTSW 16 91660334 small deletion probably benign
R7205:Son UTSW 16 91660295 small deletion probably benign
R7208:Son UTSW 16 91662102 missense unknown
R7219:Son UTSW 16 91665001 missense unknown
R7249:Son UTSW 16 91660334 small deletion probably benign
R7328:Son UTSW 16 91658390 missense probably benign 0.33
R7330:Son UTSW 16 91656598 unclassified probably benign
R7374:Son UTSW 16 91660334 small deletion probably benign
R7405:Son UTSW 16 91656691 unclassified probably benign
R7420:Son UTSW 16 91660334 small deletion probably benign
R7424:Son UTSW 16 91660334 small deletion probably benign
R7464:Son UTSW 16 91656691 unclassified probably benign
R7555:Son UTSW 16 91658922 missense probably damaging 0.99
R7645:Son UTSW 16 91660295 small deletion probably benign
R7716:Son UTSW 16 91656691 unclassified probably benign
R7718:Son UTSW 16 91660334 small deletion probably benign
R7778:Son UTSW 16 91656528 missense probably damaging 0.99
R7824:Son UTSW 16 91656528 missense probably damaging 0.99
RF007:Son UTSW 16 91659369 missense possibly damaging 0.53
RF021:Son UTSW 16 91656691 unclassified probably benign
RF041:Son UTSW 16 91656691 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTACTGATGAAGTGCCCAC -3'
(R):5'- CATTGATGGTTCCAGCATACC -3'

Sequencing Primer
(F):5'- TGATGAAGTGCCCACCAAAAAGTC -3'
(R):5'- GCTGCTCAGACTGCTCTG -3'
Posted On2019-10-17