Mutagenetix > Incidental Mutation

Incidental Mutation 'R7514:Vmn2r111'

582359

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R7514 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22548399 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 706 (T706S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: T706S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: T706S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	A	G	11: 72,195,802	L261P	probably damaging	Het
A4gnt	A	G	9: 99,620,545	I253V	probably benign	Het
Acap2	A	T	16: 31,154,567		probably null	Het
Adora2b	G	T	11: 62,265,320	M198I	probably damaging	Het
Akap5	C	A	12: 76,328,529	T245K	probably benign	Het
Aldh1a2	T	C	9: 71,284,963	I399T	probably damaging	Het
Ank2	G	A	3: 127,025,603	S473L	probably benign	Het
Anln	A	T	9: 22,360,857	D655E	probably damaging	Het
Arhgef10	T	C	8: 14,975,956	V820A	probably benign	Het
Arid1b	A	G	17: 5,341,714	K1787E	probably benign	Het
Art4	T	C	6: 136,854,741	H134R	probably benign	Het
Borcs6	G	A	11: 69,060,584	V263M	probably damaging	Het
C8a	A	T	4: 104,846,050	M314K	possibly damaging	Het
Cbfa2t3	T	G	8: 122,635,126	M386L	probably damaging	Het
Ccdc170	T	A	10: 4,546,839	V459E	probably benign	Het
Cdh4	T	A	2: 179,890,843	N699K	possibly damaging	Het
Cdk12	T	C	11: 98,222,658	L756P	unknown	Het
Chsy1	A	G	7: 66,172,120	D701G	probably damaging	Het
Cnot9	A	G	1: 74,528,762	T270A	probably benign	Het
Crat	C	T	2: 30,404,565	R497Q	probably benign	Het
Cyb5r1	A	G	1: 134,410,530	E228G	probably damaging	Het
D630003M21Rik	A	G	2: 158,217,353	L209P	probably damaging	Het
Dennd2c	T	A	3: 103,163,062	D791E	probably benign	Het
Dnah14	T	C	1: 181,628,067	I919T	probably damaging	Het
Dpp8	T	C	9: 65,078,754	L842S	probably damaging	Het
Ern1	A	G	11: 106,409,893		probably null	Het
Exo1	T	C	1: 175,906,666		probably null	Het
Fam161b	T	G	12: 84,357,738	E56A	possibly damaging	Het
Fbrsl1	T	C	5: 110,432,933	T153A	probably benign	Het
Fcgr3	T	G	1: 171,059,343	D4A	probably benign	Het
Gltp	C	T	5: 114,670,460	A193T	probably benign	Het
Gm10031	A	G	1: 156,524,754	D175G	probably benign	Het
Gm13178	A	T	4: 144,703,228	V397D	possibly damaging	Het
Gm3159	A	T	14: 4,399,690	S142C	probably damaging	Het
Gphn	T	C	12: 78,626,165	V485A	probably damaging	Het
Grik2	A	T	10: 49,523,808	N275K	probably damaging	Het
Gstt3	G	T	10: 75,776,791	Q102K	probably damaging	Het
Hivep3	T	A	4: 120,096,855	F789L	possibly damaging	Het
Ing5	A	G	1: 93,816,442	N157D	possibly damaging	Het
Itga3	C	T	11: 95,065,896	W177*	probably null	Het
Jag2	T	C	12: 112,929,052	T83A	probably benign	Het
Krt90	G	A	15: 101,553,170	T532I	unknown	Het
Lcn2	A	G	2: 32,387,849		probably null	Het
Lrig2	A	G	3: 104,465,760	S602P	probably damaging	Het
Lsm1	A	C	8: 25,792,209	R33S	probably damaging	Het
Mast4	A	T	13: 102,787,426	Y492*	probably null	Het
Mcm3	A	T	1: 20,805,896	L658Q	probably benign	Het
Myh4	G	A	11: 67,243,322		probably null	Het
Nck2	T	C	1: 43,569,221	V341A	probably benign	Het
Nucb1	T	C	7: 45,501,718		probably null	Het
Nup210l	G	C	3: 90,210,459		probably null	Het
Olfr1039	A	T	2: 86,131,628	F12I	probably damaging	Het
Olfr3	A	G	2: 36,812,639	I151T	probably benign	Het
Olfr837	A	T	9: 19,137,865	S291C	possibly damaging	Het
Olfr912	T	A	9: 38,582,051	M258K	probably damaging	Het
Olfr921	G	A	9: 38,775,678	C141Y	probably damaging	Het
Pla2g4a	G	A	1: 149,851,362	P556S	probably damaging	Het
Plat	T	C	8: 22,775,642	C234R	probably damaging	Het
Ppfia1	T	C	7: 144,517,713	I321V	probably benign	Het
Prrc1	T	A	18: 57,363,253	V92E	probably benign	Het
Prss3	A	G	6: 41,373,914	V214A	probably damaging	Het
Ptprg	G	T	14: 12,179,342	K786N	possibly damaging	Het
Rabgap1	G	T	2: 37,537,342	G645V	probably damaging	Het
Rfx4	T	C	10: 84,880,226	S470P	probably damaging	Het
Rin3	C	T	12: 102,369,650	Q607*	probably null	Het
Sema3a	A	G	5: 13,523,126	H207R	probably benign	Het
Serpinb12	G	A	1: 106,950,804	E181K	probably damaging	Het
Serpinb6c	G	A	13: 33,897,403	Q88*	probably null	Het
Shmt1	A	C	11: 60,801,986	C90W	probably damaging	Het
Slc16a13	C	T	11: 70,218,884	V264M	probably damaging	Het
Slc17a8	G	T	10: 89,592,107	P286Q	probably damaging	Het
Slc27a6	C	T	18: 58,612,221	Q576*	probably null	Het
Slc30a9	T	C	5: 67,348,078	S470P	possibly damaging	Het
Slc44a2	G	T	9: 21,342,472	K136N	possibly damaging	Het
Smarca5	A	T	8: 80,717,534	H534Q	probably damaging	Het
Son	T	G	16: 91,654,860	L165R	probably damaging	Het
Sox10	G	A	15: 79,156,221	P373L	probably benign	Het
Sp100	C	T	1: 85,681,139	R330*	probably null	Het
Srrm4	A	G	5: 116,446,511	L500P	probably damaging	Het
Tap1	T	C	17: 34,196,665	L689P	probably damaging	Het
Tfg	A	G	16: 56,705,609		probably null	Het
Tjp2	C	T	19: 24,111,522	V677I	probably benign	Het
Tmprss11g	T	G	5: 86,497,317	D85A	probably damaging	Het
Tnfsf9	T	C	17: 57,107,238	S222P	probably damaging	Het
Trank1	A	G	9: 111,364,756	N616S	probably damaging	Het
Tubgcp6	C	A	15: 89,120,525	W297L	probably damaging	Het
Twist1	T	C	12: 33,958,356	S127P	probably damaging	Het
Ubr4	T	C	4: 139,452,655	I247T	unknown	Het
Ubr5	G	A	15: 37,988,237	T2153M		Het
Utrn	A	G	10: 12,698,089	V1079A	probably benign	Het
Vcan	T	C	13: 89,704,118	T908A	probably damaging	Het
Vmn2r104	A	G	17: 20,029,529	F827L	probably damaging	Het
Vmn2r114	T	C	17: 23,308,061	D499G	probably null	Het
Vmn2r92	T	C	17: 18,171,271	S512P	probably damaging	Het
Vps4b	A	T	1: 106,780,502		probably null	Het
Vwa8	A	C	14: 78,982,234		probably null	Het
Wnt10b	T	C	15: 98,774,164	Q224R	probably benign	Het
Ylpm1	C	T	12: 85,030,494	P1331L	possibly damaging	Het
Zfhx4	G	A	3: 5,242,207	M164I	possibly damaging	Het
Zfp51	A	G	17: 21,463,500	T126A	probably benign	Het
Zfp609	A	G	9: 65,706,136	V339A	probably benign	Het
Zfp687	C	T	3: 95,007,530	R1220H	probably damaging	Het
Zfyve21	C	T	12: 111,823,815	L84F	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGAAGCTCCCAAAGGACAGG -3'
(R):5'- ACAGGACTCTCACCTACATCTTG -3'

Sequencing Primer
(F):5'- GACAGGAGAGCCAAGTATCCC -3'
(R):5'- TGGCCATCCAAACTCAGTC -3'

Posted On

2019-10-17