Incidental Mutation 'R7514:Vmn2r111'
ID 582359
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission 045587-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R7514 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22766922-22792254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22767380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 706 (T706S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect probably benign
Transcript: ENSMUST00000092491
AA Change: T706S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: T706S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A G 11: 72,086,628 (GRCm39) L261P probably damaging Het
A4gnt A G 9: 99,502,598 (GRCm39) I253V probably benign Het
AAdacl4fm3 A T 4: 144,429,798 (GRCm39) V397D possibly damaging Het
Acap2 A T 16: 30,973,385 (GRCm39) probably null Het
Adora2b G T 11: 62,156,146 (GRCm39) M198I probably damaging Het
Akap5 C A 12: 76,375,303 (GRCm39) T245K probably benign Het
Aldh1a2 T C 9: 71,192,245 (GRCm39) I399T probably damaging Het
Ank2 G A 3: 126,819,252 (GRCm39) S473L probably benign Het
Anln A T 9: 22,272,153 (GRCm39) D655E probably damaging Het
Arhgef10 T C 8: 15,025,956 (GRCm39) V820A probably benign Het
Arid1b A G 17: 5,391,989 (GRCm39) K1787E probably benign Het
Art4 T C 6: 136,831,739 (GRCm39) H134R probably benign Het
Borcs6 G A 11: 68,951,410 (GRCm39) V263M probably damaging Het
C8a A T 4: 104,703,247 (GRCm39) M314K possibly damaging Het
Cbfa2t3 T G 8: 123,361,865 (GRCm39) M386L probably damaging Het
Ccdc170 T A 10: 4,496,839 (GRCm39) V459E probably benign Het
Cdh4 T A 2: 179,532,636 (GRCm39) N699K possibly damaging Het
Cdk12 T C 11: 98,113,484 (GRCm39) L756P unknown Het
Chsy1 A G 7: 65,821,868 (GRCm39) D701G probably damaging Het
Cnot9 A G 1: 74,567,921 (GRCm39) T270A probably benign Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Csnk2a1-ps3 A G 1: 156,352,324 (GRCm39) D175G probably benign Het
Cyb5r1 A G 1: 134,338,268 (GRCm39) E228G probably damaging Het
D630003M21Rik A G 2: 158,059,273 (GRCm39) L209P probably damaging Het
Dennd2c T A 3: 103,070,378 (GRCm39) D791E probably benign Het
Dnah14 T C 1: 181,455,632 (GRCm39) I919T probably damaging Het
Dpp8 T C 9: 64,986,036 (GRCm39) L842S probably damaging Het
Ern1 A G 11: 106,300,719 (GRCm39) probably null Het
Exo1 T C 1: 175,734,232 (GRCm39) probably null Het
Fam161b T G 12: 84,404,512 (GRCm39) E56A possibly damaging Het
Fbrsl1 T C 5: 110,580,799 (GRCm39) T153A probably benign Het
Fcgr3 T G 1: 170,886,912 (GRCm39) D4A probably benign Het
Gltp C T 5: 114,808,521 (GRCm39) A193T probably benign Het
Gm3159 A T 14: 4,399,690 (GRCm38) S142C probably damaging Het
Gphn T C 12: 78,672,939 (GRCm39) V485A probably damaging Het
Grik2 A T 10: 49,399,904 (GRCm39) N275K probably damaging Het
Gstt3 G T 10: 75,612,625 (GRCm39) Q102K probably damaging Het
Hivep3 T A 4: 119,954,052 (GRCm39) F789L possibly damaging Het
Ing5 A G 1: 93,744,164 (GRCm39) N157D possibly damaging Het
Itga3 C T 11: 94,956,722 (GRCm39) W177* probably null Het
Jag2 T C 12: 112,892,672 (GRCm39) T83A probably benign Het
Krt90 G A 15: 101,461,605 (GRCm39) T532I unknown Het
Lcn2 A G 2: 32,277,861 (GRCm39) probably null Het
Lrig2 A G 3: 104,373,076 (GRCm39) S602P probably damaging Het
Lsm1 A C 8: 26,282,237 (GRCm39) R33S probably damaging Het
Mast4 A T 13: 102,923,934 (GRCm39) Y492* probably null Het
Mcm3 A T 1: 20,876,120 (GRCm39) L658Q probably benign Het
Myh4 G A 11: 67,134,148 (GRCm39) probably null Het
Nck2 T C 1: 43,608,381 (GRCm39) V341A probably benign Het
Nucb1 T C 7: 45,151,142 (GRCm39) probably null Het
Nup210l G C 3: 90,117,766 (GRCm39) probably null Het
Or1j1 A G 2: 36,702,651 (GRCm39) I151T probably benign Het
Or5al5 A T 2: 85,961,972 (GRCm39) F12I probably damaging Het
Or7g22 A T 9: 19,049,161 (GRCm39) S291C possibly damaging Het
Or8b48 T A 9: 38,493,347 (GRCm39) M258K probably damaging Het
Or8b54 G A 9: 38,686,974 (GRCm39) C141Y probably damaging Het
Pla2g4a G A 1: 149,727,113 (GRCm39) P556S probably damaging Het
Plat T C 8: 23,265,658 (GRCm39) C234R probably damaging Het
Ppfia1 T C 7: 144,071,450 (GRCm39) I321V probably benign Het
Prrc1 T A 18: 57,496,325 (GRCm39) V92E probably benign Het
Prss3 A G 6: 41,350,848 (GRCm39) V214A probably damaging Het
Ptprg G T 14: 12,179,342 (GRCm38) K786N possibly damaging Het
Rabgap1 G T 2: 37,427,354 (GRCm39) G645V probably damaging Het
Rfx4 T C 10: 84,716,090 (GRCm39) S470P probably damaging Het
Rin3 C T 12: 102,335,909 (GRCm39) Q607* probably null Het
Sema3a A G 5: 13,573,093 (GRCm39) H207R probably benign Het
Serpinb12 G A 1: 106,878,534 (GRCm39) E181K probably damaging Het
Serpinb6c G A 13: 34,081,386 (GRCm39) Q88* probably null Het
Shmt1 A C 11: 60,692,812 (GRCm39) C90W probably damaging Het
Slc16a13 C T 11: 70,109,710 (GRCm39) V264M probably damaging Het
Slc17a8 G T 10: 89,427,969 (GRCm39) P286Q probably damaging Het
Slc27a6 C T 18: 58,745,293 (GRCm39) Q576* probably null Het
Slc30a9 T C 5: 67,505,421 (GRCm39) S470P possibly damaging Het
Slc44a2 G T 9: 21,253,768 (GRCm39) K136N possibly damaging Het
Smarca5 A T 8: 81,444,163 (GRCm39) H534Q probably damaging Het
Son T G 16: 91,451,748 (GRCm39) L165R probably damaging Het
Sox10 G A 15: 79,040,421 (GRCm39) P373L probably benign Het
Sp100 C T 1: 85,608,860 (GRCm39) R330* probably null Het
Srrm4 A G 5: 116,584,570 (GRCm39) L500P probably damaging Het
Tap1 T C 17: 34,415,639 (GRCm39) L689P probably damaging Het
Tfg A G 16: 56,525,972 (GRCm39) probably null Het
Tjp2 C T 19: 24,088,886 (GRCm39) V677I probably benign Het
Tmprss11g T G 5: 86,645,176 (GRCm39) D85A probably damaging Het
Tnfsf9 T C 17: 57,414,238 (GRCm39) S222P probably damaging Het
Trank1 A G 9: 111,193,824 (GRCm39) N616S probably damaging Het
Tubgcp6 C A 15: 89,004,728 (GRCm39) W297L probably damaging Het
Twist1 T C 12: 34,008,355 (GRCm39) S127P probably damaging Het
Ubr4 T C 4: 139,179,966 (GRCm39) I247T unknown Het
Ubr5 G A 15: 37,988,481 (GRCm39) T2153M Het
Utrn A G 10: 12,573,833 (GRCm39) V1079A probably benign Het
Vcan T C 13: 89,852,237 (GRCm39) T908A probably damaging Het
Vmn2r104 A G 17: 20,249,791 (GRCm39) F827L probably damaging Het
Vmn2r114 T C 17: 23,527,035 (GRCm39) D499G probably null Het
Vmn2r92 T C 17: 18,391,533 (GRCm39) S512P probably damaging Het
Vps4b A T 1: 106,708,232 (GRCm39) probably null Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Wnt10b T C 15: 98,672,045 (GRCm39) Q224R probably benign Het
Ylpm1 C T 12: 85,077,268 (GRCm39) P1331L possibly damaging Het
Zfhx4 G A 3: 5,307,267 (GRCm39) M164I possibly damaging Het
Zfp51 A G 17: 21,683,762 (GRCm39) T126A probably benign Het
Zfp609 A G 9: 65,613,418 (GRCm39) V339A probably benign Het
Zfp687 C T 3: 94,914,841 (GRCm39) R1220H probably damaging Het
Zfyve21 C T 12: 111,790,249 (GRCm39) L84F probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22,767,734 (GRCm39) missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22,787,965 (GRCm39) missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22,787,997 (GRCm39) missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22,790,966 (GRCm39) nonsense probably null
IGL01465:Vmn2r111 APN 17 22,767,718 (GRCm39) missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22,767,553 (GRCm39) missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22,790,373 (GRCm39) missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22,788,054 (GRCm39) splice site probably benign
IGL01962:Vmn2r111 APN 17 22,767,265 (GRCm39) missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22,789,754 (GRCm39) missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22,787,837 (GRCm39) missense probably benign
IGL02519:Vmn2r111 APN 17 22,767,320 (GRCm39) missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22,790,031 (GRCm39) missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22,792,205 (GRCm39) missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22,778,023 (GRCm39) critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22,790,226 (GRCm39) missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22,789,839 (GRCm39) missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22,766,990 (GRCm39) missense probably benign
R0064:Vmn2r111 UTSW 17 22,791,053 (GRCm39) missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22,792,102 (GRCm39) missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22,790,097 (GRCm39) missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22,790,380 (GRCm39) missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22,767,041 (GRCm39) missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22,767,062 (GRCm39) missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22,767,395 (GRCm39) missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22,778,043 (GRCm39) missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22,792,085 (GRCm39) missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22,778,151 (GRCm39) splice site probably benign
R3700:Vmn2r111 UTSW 17 22,790,142 (GRCm39) nonsense probably null
R3782:Vmn2r111 UTSW 17 22,790,301 (GRCm39) missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22,778,096 (GRCm39) missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22,792,159 (GRCm39) missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22,767,637 (GRCm39) missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22,767,022 (GRCm39) missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22,790,124 (GRCm39) missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22,790,001 (GRCm39) missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22,767,083 (GRCm39) nonsense probably null
R5398:Vmn2r111 UTSW 17 22,792,252 (GRCm39) start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22,767,470 (GRCm39) missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22,767,238 (GRCm39) missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6149:Vmn2r111 UTSW 17 22,767,796 (GRCm39) missense probably benign 0.00
R6207:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22,792,070 (GRCm39) missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22,790,889 (GRCm39) missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22,767,583 (GRCm39) missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22,790,226 (GRCm39) missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22,767,165 (GRCm39) missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22,767,695 (GRCm39) missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22,790,067 (GRCm39) missense possibly damaging 0.93
R7651:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22,789,714 (GRCm39) missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22,792,083 (GRCm39) missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22,790,469 (GRCm39) missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22,792,073 (GRCm39) missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22,767,562 (GRCm39) missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22,790,274 (GRCm39) missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22,778,024 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r111 UTSW 17 22,778,023 (GRCm39) critical splice donor site probably null
R8557:Vmn2r111 UTSW 17 22,790,910 (GRCm39) nonsense probably null
R8720:Vmn2r111 UTSW 17 22,792,194 (GRCm39) missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22,767,239 (GRCm39) missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22,767,011 (GRCm39) missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22,790,822 (GRCm39) missense probably benign
R9374:Vmn2r111 UTSW 17 22,787,859 (GRCm39) missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22,778,132 (GRCm39) missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22,767,676 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAAGCTCCCAAAGGACAGG -3'
(R):5'- ACAGGACTCTCACCTACATCTTG -3'

Sequencing Primer
(F):5'- GACAGGAGAGCCAAGTATCCC -3'
(R):5'- TGGCCATCCAAACTCAGTC -3'
Posted On 2019-10-17