Incidental Mutation 'R7515:Ptgis'
ID582377
Institutional Source Beutler Lab
Gene Symbol Ptgis
Ensembl Gene ENSMUSG00000017969
Gene Nameprostaglandin I2 (prostacyclin) synthase
SynonymsCyp8a1, Pgis, Pgi2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7515 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location167191805-167240604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167206838 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 419 (K419N)
Ref Sequence ENSEMBL: ENSMUSP00000085357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018113] [ENSMUST00000088041]
Predicted Effect probably damaging
Transcript: ENSMUST00000018113
AA Change: K419N

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018113
Gene: ENSMUSG00000017969
AA Change: K419N

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 495 8.6e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000088041
AA Change: K419N

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085357
Gene: ENSMUSG00000017969
AA Change: K419N

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 496 1.9e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to prostacyclin (prostaglandin I2), a potent vasodilator and inhibitor of platelet aggregation. An imbalance of prostacyclin and its physiological antagonist thromboxane A2 contribute to the development of myocardial infarction, stroke, and atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased blood urea nitrogen and creatinine levels, thickening of the aorta with age, mildly increased blood pressure, and kidney abnormalities including cysts, fibrosis, necrosis, and renal vascular congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,628,905 E56D possibly damaging Het
Ankrd44 T C 1: 54,766,355 Y182C probably damaging Het
Anxa3 A T 5: 96,838,320 N273Y probably damaging Het
Apobec2 T C 17: 48,422,987 E217G probably damaging Het
Arhgap24 A G 5: 102,846,016 probably benign Het
Asap2 A G 12: 21,229,239 H374R possibly damaging Het
Camsap2 T C 1: 136,345,370 D23G probably damaging Het
Ccr2 T C 9: 124,106,160 V159A probably damaging Het
Cfap61 T A 2: 146,042,725 D614E unknown Het
Crb2 G A 2: 37,783,400 G103R probably damaging Het
Cyp2b9 A G 7: 26,199,171 Y317C probably damaging Het
Dhx36 A G 3: 62,472,087 V860A probably benign Het
Dnah3 T C 7: 120,073,592 D553G probably benign Het
Dnah7c T C 1: 46,457,290 S112P probably benign Het
Dnah9 A G 11: 65,841,414 F4222S probably benign Het
Ei24 T C 9: 36,789,915 D36G probably damaging Het
Etv3 G T 3: 87,528,056 R78L possibly damaging Het
Fbxo34 T C 14: 47,530,341 L437P possibly damaging Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Gabra1 T A 11: 42,154,833 D150V possibly damaging Het
Gpr158 T C 2: 21,368,281 L9P probably damaging Het
H2-M10.3 G A 17: 36,366,543 T281I probably damaging Het
Il18r1 T C 1: 40,498,670 S532P not run Het
Itpr2 T C 6: 146,327,110 D1329G probably damaging Het
Jakmip2 A T 18: 43,571,126 N384K probably benign Het
Kdsr A G 1: 106,734,560 V255A possibly damaging Het
Kifc1 A G 17: 33,884,803 L182P probably damaging Het
Lgals8 G A 13: 12,448,462 R198* probably null Het
Lrrk1 A T 7: 66,262,562 M1750K probably benign Het
Lrsam1 A G 2: 32,940,239 probably null Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Mcc G T 18: 44,493,432 H366N probably benign Het
Mif4gd A G 11: 115,608,396 V220A possibly damaging Het
Mtmr12 T A 15: 12,269,951 F708L probably damaging Het
Muc16 A T 9: 18,639,662 W5112R probably benign Het
Ndrg2 A G 14: 51,908,923 I140T probably benign Het
Nid2 C A 14: 19,791,567 Q887K probably benign Het
Nop16 A T 13: 54,589,737 S48T possibly damaging Het
Nrap G A 19: 56,366,427 T489I possibly damaging Het
Oas1e C T 5: 120,791,886 G189D probably damaging Het
Olfr1238 A G 2: 89,406,906 Y58H possibly damaging Het
Olfr854 A T 9: 19,566,653 C244S probably damaging Het
Pcdha5 A T 18: 36,962,118 D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phldb2 C T 16: 45,774,240 D901N possibly damaging Het
Piezo1 T C 8: 122,485,296 H2058R Het
Ptprz1 T C 6: 23,022,267 F1714L probably damaging Het
Rasa2 T C 9: 96,552,300 probably null Het
Recql C T 6: 142,374,885 D146N probably damaging Het
Rnf6 T G 5: 146,211,792 S139R probably damaging Het
Rock1 A G 18: 10,067,631 S1301P probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Setd5 T A 6: 113,110,889 I137N probably damaging Het
Sf3b6 G A 12: 4,820,619 R19Q probably damaging Het
Slc15a5 T A 6: 138,043,498 H279L possibly damaging Het
Slc26a9 A G 1: 131,753,973 T175A probably damaging Het
Sspo A T 6: 48,493,886 N36I probably damaging Het
Supv3l1 A C 10: 62,432,311 F585C probably damaging Het
Tnrc6c G T 11: 117,741,681 V1070L probably benign Het
Vmn2r53 T A 7: 12,581,919 M658L probably benign Het
Zc3h13 A G 14: 75,308,909 D150G unknown Het
Zfp607b T C 7: 27,703,496 V459A probably benign Het
Zfp653 T C 9: 22,071,131 R71G probably damaging Het
Other mutations in Ptgis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Ptgis APN 2 167206830 missense probably damaging 1.00
IGL01859:Ptgis APN 2 167214806 critical splice donor site probably null
IGL01965:Ptgis APN 2 167208253 missense probably benign 0.00
IGL02102:Ptgis APN 2 167225447 missense probably damaging 0.99
IGL02296:Ptgis APN 2 167206737 missense probably damaging 1.00
IGL02434:Ptgis APN 2 167240342 critical splice donor site probably null
PIT4142001:Ptgis UTSW 2 167206830 missense probably damaging 1.00
R0332:Ptgis UTSW 2 167214833 missense probably damaging 0.99
R0614:Ptgis UTSW 2 167206882 missense probably damaging 1.00
R1733:Ptgis UTSW 2 167191968 unclassified probably benign
R1756:Ptgis UTSW 2 167206803 missense probably damaging 1.00
R1779:Ptgis UTSW 2 167214858 missense probably benign 0.01
R2004:Ptgis UTSW 2 167214849 missense possibly damaging 0.94
R2019:Ptgis UTSW 2 167208279 missense probably damaging 1.00
R2019:Ptgis UTSW 2 167214810 nonsense probably null
R2512:Ptgis UTSW 2 167207276 missense probably damaging 0.99
R2679:Ptgis UTSW 2 167208193 missense probably benign 0.38
R4962:Ptgis UTSW 2 167225274 critical splice donor site probably null
R5174:Ptgis UTSW 2 167203470 critical splice acceptor site probably null
R5471:Ptgis UTSW 2 167224119 missense probably benign 0.03
R5717:Ptgis UTSW 2 167208364 splice site probably benign
R7268:Ptgis UTSW 2 167206756 missense probably benign 0.10
R7513:Ptgis UTSW 2 167225283 missense probably benign 0.00
R7615:Ptgis UTSW 2 167223988 missense probably damaging 1.00
R7736:Ptgis UTSW 2 167191971 missense unknown
R7891:Ptgis UTSW 2 167227514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCACTAATGGGCCCCTTC -3'
(R):5'- CAAGCCTTTAACCAGTCCAGTC -3'

Sequencing Primer
(F):5'- ATGCTCCGCTAACCCTGTG -3'
(R):5'- CACTTCCCATTGTGCTCAGTAGTAG -3'
Posted On2019-10-17