Incidental Mutation 'R7515:Etv3'
ID582379
Institutional Source Beutler Lab
Gene Symbol Etv3
Ensembl Gene ENSMUSG00000003382
Gene Nameets variant 3
SynonymsETS-domain transcriptional repressor, Pe1, METS
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7515 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location87525407-87540156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87528056 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 78 (R78L)
Ref Sequence ENSEMBL: ENSMUSP00000112915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117293] [ENSMUST00000119109] [ENSMUST00000170036]
Predicted Effect probably benign
Transcript: ENSMUST00000117293
AA Change: R78L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114047
Gene: ENSMUSG00000003382
AA Change: R78L

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119109
AA Change: R78L

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112915
Gene: ENSMUSG00000003382
AA Change: R78L

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
low complexity region 170 177 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 504 513 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170036
AA Change: R78L

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127419
Gene: ENSMUSG00000003382
AA Change: R78L

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
low complexity region 170 177 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 504 513 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,628,905 E56D possibly damaging Het
Ankrd44 T C 1: 54,766,355 Y182C probably damaging Het
Anxa3 A T 5: 96,838,320 N273Y probably damaging Het
Apobec2 T C 17: 48,422,987 E217G probably damaging Het
Arhgap24 A G 5: 102,846,016 probably benign Het
Asap2 A G 12: 21,229,239 H374R possibly damaging Het
Camsap2 T C 1: 136,345,370 D23G probably damaging Het
Ccr2 T C 9: 124,106,160 V159A probably damaging Het
Cfap61 T A 2: 146,042,725 D614E unknown Het
Crb2 G A 2: 37,783,400 G103R probably damaging Het
Cyp2b9 A G 7: 26,199,171 Y317C probably damaging Het
Dhx36 A G 3: 62,472,087 V860A probably benign Het
Dnah3 T C 7: 120,073,592 D553G probably benign Het
Dnah7c T C 1: 46,457,290 S112P probably benign Het
Dnah9 A G 11: 65,841,414 F4222S probably benign Het
Ei24 T C 9: 36,789,915 D36G probably damaging Het
Fbxo34 T C 14: 47,530,341 L437P possibly damaging Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Gabra1 T A 11: 42,154,833 D150V possibly damaging Het
Gpr158 T C 2: 21,368,281 L9P probably damaging Het
H2-M10.3 G A 17: 36,366,543 T281I probably damaging Het
Il18r1 T C 1: 40,498,670 S532P not run Het
Itpr2 T C 6: 146,327,110 D1329G probably damaging Het
Jakmip2 A T 18: 43,571,126 N384K probably benign Het
Kdsr A G 1: 106,734,560 V255A possibly damaging Het
Kifc1 A G 17: 33,884,803 L182P probably damaging Het
Lgals8 G A 13: 12,448,462 R198* probably null Het
Lrrk1 A T 7: 66,262,562 M1750K probably benign Het
Lrsam1 A G 2: 32,940,239 probably null Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Mcc G T 18: 44,493,432 H366N probably benign Het
Mif4gd A G 11: 115,608,396 V220A possibly damaging Het
Mtmr12 T A 15: 12,269,951 F708L probably damaging Het
Muc16 A T 9: 18,639,662 W5112R probably benign Het
Ndrg2 A G 14: 51,908,923 I140T probably benign Het
Nid2 C A 14: 19,791,567 Q887K probably benign Het
Nop16 A T 13: 54,589,737 S48T possibly damaging Het
Nrap G A 19: 56,366,427 T489I possibly damaging Het
Oas1e C T 5: 120,791,886 G189D probably damaging Het
Olfr1238 A G 2: 89,406,906 Y58H possibly damaging Het
Olfr854 A T 9: 19,566,653 C244S probably damaging Het
Pcdha5 A T 18: 36,962,118 D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phldb2 C T 16: 45,774,240 D901N possibly damaging Het
Piezo1 T C 8: 122,485,296 H2058R Het
Ptgis T A 2: 167,206,838 K419N possibly damaging Het
Ptprz1 T C 6: 23,022,267 F1714L probably damaging Het
Rasa2 T C 9: 96,552,300 probably null Het
Recql C T 6: 142,374,885 D146N probably damaging Het
Rnf6 T G 5: 146,211,792 S139R probably damaging Het
Rock1 A G 18: 10,067,631 S1301P probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Setd5 T A 6: 113,110,889 I137N probably damaging Het
Sf3b6 G A 12: 4,820,619 R19Q probably damaging Het
Slc15a5 T A 6: 138,043,498 H279L possibly damaging Het
Slc26a9 A G 1: 131,753,973 T175A probably damaging Het
Sspo A T 6: 48,493,886 N36I probably damaging Het
Supv3l1 A C 10: 62,432,311 F585C probably damaging Het
Tnrc6c G T 11: 117,741,681 V1070L probably benign Het
Vmn2r53 T A 7: 12,581,919 M658L probably benign Het
Zc3h13 A G 14: 75,308,909 D150G unknown Het
Zfp607b T C 7: 27,703,496 V459A probably benign Het
Zfp653 T C 9: 22,071,131 R71G probably damaging Het
Other mutations in Etv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Etv3 APN 3 87535718 missense possibly damaging 0.68
IGL02613:Etv3 APN 3 87536395 missense possibly damaging 0.53
IGL02698:Etv3 APN 3 87536578 missense possibly damaging 0.53
Rodeo UTSW 3 87536031 nonsense probably null
Schooled UTSW 3 87529270 missense probably damaging 1.00
R0056:Etv3 UTSW 3 87535828 missense possibly damaging 0.86
R2074:Etv3 UTSW 3 87536219 missense probably benign
R2104:Etv3 UTSW 3 87536062 missense possibly damaging 0.53
R4120:Etv3 UTSW 3 87536282 missense probably benign 0.00
R4923:Etv3 UTSW 3 87535916 missense possibly damaging 0.96
R4960:Etv3 UTSW 3 87528061 missense probably damaging 1.00
R5642:Etv3 UTSW 3 87536015 missense possibly damaging 0.96
R5907:Etv3 UTSW 3 87535543 missense probably benign 0.23
R6020:Etv3 UTSW 3 87529364 missense probably benign
R6882:Etv3 UTSW 3 87529270 missense probably damaging 1.00
R7570:Etv3 UTSW 3 87536031 nonsense probably null
R8340:Etv3 UTSW 3 87536549 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCCGGATTGGGCCTACAAAG -3'
(R):5'- AGCCACATTGGAACTCCCTC -3'

Sequencing Primer
(F):5'- ATTGGGCCTACAAAGCCGAGTC -3'
(R):5'- TTTCAAGTCACACACCACTCGAGG -3'
Posted On2019-10-17