Incidental Mutation 'R7515:Setd5'
ID582387
Institutional Source Beutler Lab
Gene Symbol Setd5
Ensembl Gene ENSMUSG00000034269
Gene NameSET domain containing 5
Synonyms2900045N06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7515 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113077365-113153435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113110889 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 137 (I137N)
Ref Sequence ENSEMBL: ENSMUSP00000108780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042889] [ENSMUST00000113155] [ENSMUST00000113157]
Predicted Effect probably damaging
Transcript: ENSMUST00000042889
AA Change: I118N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047398
Gene: ENSMUSG00000034269
AA Change: I118N

DomainStartEndE-ValueType
low complexity region 165 180 N/A INTRINSIC
SET 272 396 1.09e-23 SMART
low complexity region 417 429 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 476 495 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
low complexity region 561 572 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 1082 1107 N/A INTRINSIC
low complexity region 1122 1138 N/A INTRINSIC
low complexity region 1250 1259 N/A INTRINSIC
low complexity region 1283 1301 N/A INTRINSIC
low complexity region 1335 1346 N/A INTRINSIC
low complexity region 1352 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113155
AA Change: I137N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108780
Gene: ENSMUSG00000034269
AA Change: I137N

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113157
AA Change: I137N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108782
Gene: ENSMUSG00000034269
AA Change: I137N

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
SET 291 415 1.09e-23 SMART
low complexity region 436 448 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 558 571 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 619 640 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 869 885 N/A INTRINSIC
low complexity region 1101 1126 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1269 1278 N/A INTRINSIC
low complexity region 1302 1320 N/A INTRINSIC
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This function of this gene has yet to be determined but mutations in this gene have been associated with autosomal dominant mental retardation-23. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,628,905 E56D possibly damaging Het
Ankrd44 T C 1: 54,766,355 Y182C probably damaging Het
Anxa3 A T 5: 96,838,320 N273Y probably damaging Het
Apobec2 T C 17: 48,422,987 E217G probably damaging Het
Arhgap24 A G 5: 102,846,016 probably benign Het
Asap2 A G 12: 21,229,239 H374R possibly damaging Het
Camsap2 T C 1: 136,345,370 D23G probably damaging Het
Ccr2 T C 9: 124,106,160 V159A probably damaging Het
Cfap61 T A 2: 146,042,725 D614E unknown Het
Crb2 G A 2: 37,783,400 G103R probably damaging Het
Cyp2b9 A G 7: 26,199,171 Y317C probably damaging Het
Dhx36 A G 3: 62,472,087 V860A probably benign Het
Dnah3 T C 7: 120,073,592 D553G probably benign Het
Dnah7c T C 1: 46,457,290 S112P probably benign Het
Dnah9 A G 11: 65,841,414 F4222S probably benign Het
Ei24 T C 9: 36,789,915 D36G probably damaging Het
Etv3 G T 3: 87,528,056 R78L possibly damaging Het
Fbxo34 T C 14: 47,530,341 L437P possibly damaging Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Gabra1 T A 11: 42,154,833 D150V possibly damaging Het
Gpr158 T C 2: 21,368,281 L9P probably damaging Het
H2-M10.3 G A 17: 36,366,543 T281I probably damaging Het
Il18r1 T C 1: 40,498,670 S532P not run Het
Itpr2 T C 6: 146,327,110 D1329G probably damaging Het
Jakmip2 A T 18: 43,571,126 N384K probably benign Het
Kdsr A G 1: 106,734,560 V255A possibly damaging Het
Kifc1 A G 17: 33,884,803 L182P probably damaging Het
Lgals8 G A 13: 12,448,462 R198* probably null Het
Lrrk1 A T 7: 66,262,562 M1750K probably benign Het
Lrsam1 A G 2: 32,940,239 probably null Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Mcc G T 18: 44,493,432 H366N probably benign Het
Mif4gd A G 11: 115,608,396 V220A possibly damaging Het
Mtmr12 T A 15: 12,269,951 F708L probably damaging Het
Muc16 A T 9: 18,639,662 W5112R probably benign Het
Ndrg2 A G 14: 51,908,923 I140T probably benign Het
Nid2 C A 14: 19,791,567 Q887K probably benign Het
Nop16 A T 13: 54,589,737 S48T possibly damaging Het
Nrap G A 19: 56,366,427 T489I possibly damaging Het
Oas1e C T 5: 120,791,886 G189D probably damaging Het
Olfr1238 A G 2: 89,406,906 Y58H possibly damaging Het
Olfr854 A T 9: 19,566,653 C244S probably damaging Het
Pcdha5 A T 18: 36,962,118 D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phldb2 C T 16: 45,774,240 D901N possibly damaging Het
Piezo1 T C 8: 122,485,296 H2058R Het
Ptgis T A 2: 167,206,838 K419N possibly damaging Het
Ptprz1 T C 6: 23,022,267 F1714L probably damaging Het
Rasa2 T C 9: 96,552,300 probably null Het
Recql C T 6: 142,374,885 D146N probably damaging Het
Rnf6 T G 5: 146,211,792 S139R probably damaging Het
Rock1 A G 18: 10,067,631 S1301P probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Sf3b6 G A 12: 4,820,619 R19Q probably damaging Het
Slc15a5 T A 6: 138,043,498 H279L possibly damaging Het
Slc26a9 A G 1: 131,753,973 T175A probably damaging Het
Sspo A T 6: 48,493,886 N36I probably damaging Het
Supv3l1 A C 10: 62,432,311 F585C probably damaging Het
Tnrc6c G T 11: 117,741,681 V1070L probably benign Het
Vmn2r53 T A 7: 12,581,919 M658L probably benign Het
Zc3h13 A G 14: 75,308,909 D150G unknown Het
Zfp607b T C 7: 27,703,496 V459A probably benign Het
Zfp653 T C 9: 22,071,131 R71G probably damaging Het
Other mutations in Setd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Setd5 APN 6 113111414 missense probably damaging 1.00
IGL02102:Setd5 APN 6 113150985 nonsense probably null
IGL02105:Setd5 APN 6 113117580 missense probably damaging 1.00
IGL02202:Setd5 APN 6 113151015 missense probably benign 0.01
IGL02221:Setd5 APN 6 113121170 splice site probably benign
IGL02382:Setd5 APN 6 113143640 missense probably benign
IGL02394:Setd5 APN 6 113110898 missense probably benign 0.00
IGL02442:Setd5 APN 6 113110380 missense possibly damaging 0.93
IGL02480:Setd5 APN 6 113143809 missense probably damaging 1.00
IGL02940:Setd5 APN 6 113114938 missense possibly damaging 0.92
R0320:Setd5 UTSW 6 113111481 missense probably damaging 1.00
R0479:Setd5 UTSW 6 113115033 missense probably damaging 1.00
R0514:Setd5 UTSW 6 113119437 nonsense probably null
R1528:Setd5 UTSW 6 113121738 missense probably damaging 0.99
R1530:Setd5 UTSW 6 113109913 missense probably damaging 1.00
R2176:Setd5 UTSW 6 113151153 missense probably benign 0.23
R2191:Setd5 UTSW 6 113111429 nonsense probably null
R2286:Setd5 UTSW 6 113119610 missense possibly damaging 0.69
R4163:Setd5 UTSW 6 113119584 missense probably benign
R4294:Setd5 UTSW 6 113111320 intron probably benign
R4300:Setd5 UTSW 6 113150162 missense probably damaging 1.00
R4342:Setd5 UTSW 6 113111320 intron probably benign
R4370:Setd5 UTSW 6 113121805 missense probably damaging 1.00
R4854:Setd5 UTSW 6 113151399 missense probably damaging 1.00
R4858:Setd5 UTSW 6 113149566 missense probably damaging 1.00
R5057:Setd5 UTSW 6 113137961 missense probably damaging 0.96
R5345:Setd5 UTSW 6 113116007 missense probably damaging 1.00
R5529:Setd5 UTSW 6 113121568 missense probably damaging 1.00
R5556:Setd5 UTSW 6 113147502 missense probably benign 0.00
R5582:Setd5 UTSW 6 113114925 missense probably damaging 1.00
R5838:Setd5 UTSW 6 113119435 missense probably benign 0.40
R5941:Setd5 UTSW 6 113128490 missense probably damaging 1.00
R6009:Setd5 UTSW 6 113110519 missense probably damaging 0.99
R6146:Setd5 UTSW 6 113121812 critical splice donor site probably null
R6394:Setd5 UTSW 6 113115544 missense probably damaging 1.00
R6694:Setd5 UTSW 6 113143708 missense probably benign
R7058:Setd5 UTSW 6 113115571 missense probably benign 0.16
R7060:Setd5 UTSW 6 113117382 missense probably damaging 1.00
R7199:Setd5 UTSW 6 113121138 missense probably benign 0.03
R7238:Setd5 UTSW 6 113121130 missense probably damaging 1.00
R7296:Setd5 UTSW 6 113147557 missense probably benign 0.21
R7438:Setd5 UTSW 6 113115082 missense possibly damaging 0.74
R7621:Setd5 UTSW 6 113144049 missense possibly damaging 0.85
R7652:Setd5 UTSW 6 113121764 missense probably damaging 1.00
X0017:Setd5 UTSW 6 113150168 missense probably null 1.00
Z1176:Setd5 UTSW 6 113138096 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACTAGGTGAGAATTGCTGAC -3'
(R):5'- AGTAGTTTCCACACTCTGCTG -3'

Sequencing Primer
(F):5'- CTAGGTGAGAATTGCTGACAACAAG -3'
(R):5'- CTGGTGCTTACAAAGGATAATTTGAC -3'
Posted On2019-10-17