Mutagenetix > Incidental Mutations

Incidental Mutation 'R7515:Lrrk1'

582394

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7515 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66262562 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1750 (M1750K)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000145954]

Predicted Effect

probably benign
Transcript: ENSMUST00000015277
AA Change: M1750K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: M1750K

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145954

SMART Domains

Protein: ENSMUSP00000114938
Gene: ENSMUSG00000015133

Domain	Start	End	E-Value	Type
low complexity region	24	34	N/A	INTRINSIC
low complexity region	124	137	N/A	INTRINSIC
Pfam:Pkinase	158	435	6.6e-46	PFAM
Pfam:Pkinase_Tyr	159	435	5.8e-40	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd36	A	T	11: 5,628,905	E56D	possibly damaging	Het
Ankrd44	T	C	1: 54,766,355	Y182C	probably damaging	Het
Anxa3	A	T	5: 96,838,320	N273Y	probably damaging	Het
Apobec2	T	C	17: 48,422,987	E217G	probably damaging	Het
Arhgap24	A	G	5: 102,846,016		probably benign	Het
Asap2	A	G	12: 21,229,239	H374R	possibly damaging	Het
Camsap2	T	C	1: 136,345,370	D23G	probably damaging	Het
Ccr2	T	C	9: 124,106,160	V159A	probably damaging	Het
Cfap61	T	A	2: 146,042,725	D614E	unknown	Het
Crb2	G	A	2: 37,783,400	G103R	probably damaging	Het
Cyp2b9	A	G	7: 26,199,171	Y317C	probably damaging	Het
Dhx36	A	G	3: 62,472,087	V860A	probably benign	Het
Dnah3	T	C	7: 120,073,592	D553G	probably benign	Het
Dnah7c	T	C	1: 46,457,290	S112P	probably benign	Het
Dnah9	A	G	11: 65,841,414	F4222S	probably benign	Het
Ei24	T	C	9: 36,789,915	D36G	probably damaging	Het
Etv3	G	T	3: 87,528,056	R78L	possibly damaging	Het
Fbxo34	T	C	14: 47,530,341	L437P	possibly damaging	Het
Foxn1	T	C	11: 78,371,144	D133G	possibly damaging	Het
Gabra1	T	A	11: 42,154,833	D150V	possibly damaging	Het
Gpr158	T	C	2: 21,368,281	L9P	probably damaging	Het
H2-M10.3	G	A	17: 36,366,543	T281I	probably damaging	Het
Il18r1	T	C	1: 40,498,670	S532P	not run	Het
Itpr2	T	C	6: 146,327,110	D1329G	probably damaging	Het
Jakmip2	A	T	18: 43,571,126	N384K	probably benign	Het
Kdsr	A	G	1: 106,734,560	V255A	possibly damaging	Het
Kifc1	A	G	17: 33,884,803	L182P	probably damaging	Het
Lgals8	G	A	13: 12,448,462	R198*	probably null	Het
Lrsam1	A	G	2: 32,940,239		probably null	Het
Lztr1	C	T	16: 17,509,661	A76V	possibly damaging	Het
Mcc	G	T	18: 44,493,432	H366N	probably benign	Het
Mif4gd	A	G	11: 115,608,396	V220A	possibly damaging	Het
Mtmr12	T	A	15: 12,269,951	F708L	probably damaging	Het
Muc16	A	T	9: 18,639,662	W5112R	probably benign	Het
Ndrg2	A	G	14: 51,908,923	I140T	probably benign	Het
Nid2	C	A	14: 19,791,567	Q887K	probably benign	Het
Nop16	A	T	13: 54,589,737	S48T	possibly damaging	Het
Nrap	G	A	19: 56,366,427	T489I	possibly damaging	Het
Oas1e	C	T	5: 120,791,886	G189D	probably damaging	Het
Olfr1238	A	G	2: 89,406,906	Y58H	possibly damaging	Het
Olfr854	A	T	9: 19,566,653	C244S	probably damaging	Het
Pcdha5	A	T	18: 36,962,118	D560V	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Phldb2	C	T	16: 45,774,240	D901N	possibly damaging	Het
Piezo1	T	C	8: 122,485,296	H2058R		Het
Ptgis	T	A	2: 167,206,838	K419N	possibly damaging	Het
Ptprz1	T	C	6: 23,022,267	F1714L	probably damaging	Het
Rasa2	T	C	9: 96,552,300		probably null	Het
Recql	C	T	6: 142,374,885	D146N	probably damaging	Het
Rnf6	T	G	5: 146,211,792	S139R	probably damaging	Het
Rock1	A	G	18: 10,067,631	S1301P	probably damaging	Het
Safb2	A	G	17: 56,582,982		probably null	Het
Setd5	T	A	6: 113,110,889	I137N	probably damaging	Het
Sf3b6	G	A	12: 4,820,619	R19Q	probably damaging	Het
Slc15a5	T	A	6: 138,043,498	H279L	possibly damaging	Het
Slc26a9	A	G	1: 131,753,973	T175A	probably damaging	Het
Sspo	A	T	6: 48,493,886	N36I	probably damaging	Het
Supv3l1	A	C	10: 62,432,311	F585C	probably damaging	Het
Tnrc6c	G	T	11: 117,741,681	V1070L	probably benign	Het
Vmn2r53	T	A	7: 12,581,919	M658L	probably benign	Het
Zc3h13	A	G	14: 75,308,909	D150G	unknown	Het
Zfp607b	T	C	7: 27,703,496	V459A	probably benign	Het
Zfp653	T	C	9: 22,071,131	R71G	probably damaging	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CTCGCTGTACATGATGCTCAC -3'
(R):5'- AGAACCCTTACCCAGTGAAGG -3'

Sequencing Primer
(F):5'- ATGCTCACATCCGCGATG -3'
(R):5'- CCTTACCCAGTGAAGGCAATG -3'

Posted On

2019-10-17