Incidental Mutation 'R7515:Muc16'
ID582397
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R7515 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18639662 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 5112 (W5112R)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: W5112R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,628,905 E56D possibly damaging Het
Ankrd44 T C 1: 54,766,355 Y182C probably damaging Het
Anxa3 A T 5: 96,838,320 N273Y probably damaging Het
Apobec2 T C 17: 48,422,987 E217G probably damaging Het
Arhgap24 A G 5: 102,846,016 probably benign Het
Asap2 A G 12: 21,229,239 H374R possibly damaging Het
Camsap2 T C 1: 136,345,370 D23G probably damaging Het
Ccr2 T C 9: 124,106,160 V159A probably damaging Het
Cfap61 T A 2: 146,042,725 D614E unknown Het
Crb2 G A 2: 37,783,400 G103R probably damaging Het
Cyp2b9 A G 7: 26,199,171 Y317C probably damaging Het
Dhx36 A G 3: 62,472,087 V860A probably benign Het
Dnah3 T C 7: 120,073,592 D553G probably benign Het
Dnah7c T C 1: 46,457,290 S112P probably benign Het
Dnah9 A G 11: 65,841,414 F4222S probably benign Het
Ei24 T C 9: 36,789,915 D36G probably damaging Het
Etv3 G T 3: 87,528,056 R78L possibly damaging Het
Fbxo34 T C 14: 47,530,341 L437P possibly damaging Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Gabra1 T A 11: 42,154,833 D150V possibly damaging Het
Gpr158 T C 2: 21,368,281 L9P probably damaging Het
H2-M10.3 G A 17: 36,366,543 T281I probably damaging Het
Il18r1 T C 1: 40,498,670 S532P not run Het
Itpr2 T C 6: 146,327,110 D1329G probably damaging Het
Jakmip2 A T 18: 43,571,126 N384K probably benign Het
Kdsr A G 1: 106,734,560 V255A possibly damaging Het
Kifc1 A G 17: 33,884,803 L182P probably damaging Het
Lgals8 G A 13: 12,448,462 R198* probably null Het
Lrrk1 A T 7: 66,262,562 M1750K probably benign Het
Lrsam1 A G 2: 32,940,239 probably null Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Mcc G T 18: 44,493,432 H366N probably benign Het
Mif4gd A G 11: 115,608,396 V220A possibly damaging Het
Mtmr12 T A 15: 12,269,951 F708L probably damaging Het
Ndrg2 A G 14: 51,908,923 I140T probably benign Het
Nid2 C A 14: 19,791,567 Q887K probably benign Het
Nop16 A T 13: 54,589,737 S48T possibly damaging Het
Nrap G A 19: 56,366,427 T489I possibly damaging Het
Oas1e C T 5: 120,791,886 G189D probably damaging Het
Olfr1238 A G 2: 89,406,906 Y58H possibly damaging Het
Olfr854 A T 9: 19,566,653 C244S probably damaging Het
Pcdha5 A T 18: 36,962,118 D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phldb2 C T 16: 45,774,240 D901N possibly damaging Het
Piezo1 T C 8: 122,485,296 H2058R Het
Ptgis T A 2: 167,206,838 K419N possibly damaging Het
Ptprz1 T C 6: 23,022,267 F1714L probably damaging Het
Rasa2 T C 9: 96,552,300 probably null Het
Recql C T 6: 142,374,885 D146N probably damaging Het
Rnf6 T G 5: 146,211,792 S139R probably damaging Het
Rock1 A G 18: 10,067,631 S1301P probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Setd5 T A 6: 113,110,889 I137N probably damaging Het
Sf3b6 G A 12: 4,820,619 R19Q probably damaging Het
Slc15a5 T A 6: 138,043,498 H279L possibly damaging Het
Slc26a9 A G 1: 131,753,973 T175A probably damaging Het
Sspo A T 6: 48,493,886 N36I probably damaging Het
Supv3l1 A C 10: 62,432,311 F585C probably damaging Het
Tnrc6c G T 11: 117,741,681 V1070L probably benign Het
Vmn2r53 T A 7: 12,581,919 M658L probably benign Het
Zc3h13 A G 14: 75,308,909 D150G unknown Het
Zfp607b T C 7: 27,703,496 V459A probably benign Het
Zfp653 T C 9: 22,071,131 R71G probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTCTGGGACATAGCTAGTGACC -3'
(R):5'- TTCATCACCCACTCTGCAGG -3'

Sequencing Primer
(F):5'- ACATAGCTAGTGACCACTGATG -3'
(R):5'- AGGACAACCCAGTTTATCGGTGTC -3'
Posted On2019-10-17