Incidental Mutation 'R7515:Ccr2'
ID582401
Institutional Source Beutler Lab
Gene Symbol Ccr2
Ensembl Gene ENSMUSG00000049103
Gene Namechemokine (C-C motif) receptor 2
SynonymsCmkbr2, CKR2A, CC-CKR-2, CKR2B, CCR2B, CKR2, CCR2A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7515 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location124101950-124113557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124106160 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 159 (V159A)
Ref Sequence ENSEMBL: ENSMUSP00000049909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055918] [ENSMUST00000165984] [ENSMUST00000168841] [ENSMUST00000171719]
Predicted Effect probably damaging
Transcript: ENSMUST00000055918
AA Change: V159A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049909
Gene: ENSMUSG00000049103
AA Change: V159A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 66 332 4.8e-8 PFAM
Pfam:7tm_1 72 318 1.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165984
AA Change: V159A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128734
Gene: ENSMUSG00000049103
AA Change: V159A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 66 332 4.8e-8 PFAM
Pfam:7tm_1 72 318 2.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168841
AA Change: V159A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132453
Gene: ENSMUSG00000049103
AA Change: V159A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 66 332 4.8e-8 PFAM
Pfam:7tm_1 72 318 2.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171719
AA Change: V159A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130112
Gene: ENSMUSG00000049103
AA Change: V159A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 66 332 4.8e-8 PFAM
Pfam:7tm_1 72 318 2.9e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two isoforms of a receptor for monocyte chemoattractant protein-1, a chemokine which specifically mediates monocyte chemotaxis. Monocyte chemoattractant protein-1 is involved in monocyte infiltration in inflammatory diseases such as rheumatoid arthritis as well as in the inflammatory response against tumors. The receptors encoded by this gene mediate agonist-dependent calcium mobilization and inhibition of adenylyl cyclase. This gene is located in the chemokine receptor gene cluster region. Two alternatively spliced transcript variants are expressed by the gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in leukocyte physiology that result in altered response to myocardial infarction and increased susceptibility to bacterial infection and colitis. Mice may also exhibit retinal degeneration and alcohol aversion depending on the knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,628,905 E56D possibly damaging Het
Ankrd44 T C 1: 54,766,355 Y182C probably damaging Het
Anxa3 A T 5: 96,838,320 N273Y probably damaging Het
Apobec2 T C 17: 48,422,987 E217G probably damaging Het
Arhgap24 A G 5: 102,846,016 probably benign Het
Asap2 A G 12: 21,229,239 H374R possibly damaging Het
Camsap2 T C 1: 136,345,370 D23G probably damaging Het
Cfap61 T A 2: 146,042,725 D614E unknown Het
Crb2 G A 2: 37,783,400 G103R probably damaging Het
Cyp2b9 A G 7: 26,199,171 Y317C probably damaging Het
Dhx36 A G 3: 62,472,087 V860A probably benign Het
Dnah3 T C 7: 120,073,592 D553G probably benign Het
Dnah7c T C 1: 46,457,290 S112P probably benign Het
Dnah9 A G 11: 65,841,414 F4222S probably benign Het
Ei24 T C 9: 36,789,915 D36G probably damaging Het
Etv3 G T 3: 87,528,056 R78L possibly damaging Het
Fbxo34 T C 14: 47,530,341 L437P possibly damaging Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Gabra1 T A 11: 42,154,833 D150V possibly damaging Het
Gpr158 T C 2: 21,368,281 L9P probably damaging Het
H2-M10.3 G A 17: 36,366,543 T281I probably damaging Het
Il18r1 T C 1: 40,498,670 S532P not run Het
Itpr2 T C 6: 146,327,110 D1329G probably damaging Het
Jakmip2 A T 18: 43,571,126 N384K probably benign Het
Kdsr A G 1: 106,734,560 V255A possibly damaging Het
Kifc1 A G 17: 33,884,803 L182P probably damaging Het
Lgals8 G A 13: 12,448,462 R198* probably null Het
Lrrk1 A T 7: 66,262,562 M1750K probably benign Het
Lrsam1 A G 2: 32,940,239 probably null Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Mcc G T 18: 44,493,432 H366N probably benign Het
Mif4gd A G 11: 115,608,396 V220A possibly damaging Het
Mtmr12 T A 15: 12,269,951 F708L probably damaging Het
Muc16 A T 9: 18,639,662 W5112R probably benign Het
Ndrg2 A G 14: 51,908,923 I140T probably benign Het
Nid2 C A 14: 19,791,567 Q887K probably benign Het
Nop16 A T 13: 54,589,737 S48T possibly damaging Het
Nrap G A 19: 56,366,427 T489I possibly damaging Het
Oas1e C T 5: 120,791,886 G189D probably damaging Het
Olfr1238 A G 2: 89,406,906 Y58H possibly damaging Het
Olfr854 A T 9: 19,566,653 C244S probably damaging Het
Pcdha5 A T 18: 36,962,118 D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phldb2 C T 16: 45,774,240 D901N possibly damaging Het
Piezo1 T C 8: 122,485,296 H2058R Het
Ptgis T A 2: 167,206,838 K419N possibly damaging Het
Ptprz1 T C 6: 23,022,267 F1714L probably damaging Het
Rasa2 T C 9: 96,552,300 probably null Het
Recql C T 6: 142,374,885 D146N probably damaging Het
Rnf6 T G 5: 146,211,792 S139R probably damaging Het
Rock1 A G 18: 10,067,631 S1301P probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Setd5 T A 6: 113,110,889 I137N probably damaging Het
Sf3b6 G A 12: 4,820,619 R19Q probably damaging Het
Slc15a5 T A 6: 138,043,498 H279L possibly damaging Het
Slc26a9 A G 1: 131,753,973 T175A probably damaging Het
Sspo A T 6: 48,493,886 N36I probably damaging Het
Supv3l1 A C 10: 62,432,311 F585C probably damaging Het
Tnrc6c G T 11: 117,741,681 V1070L probably benign Het
Vmn2r53 T A 7: 12,581,919 M658L probably benign Het
Zc3h13 A G 14: 75,308,909 D150G unknown Het
Zfp607b T C 7: 27,703,496 V459A probably benign Het
Zfp653 T C 9: 22,071,131 R71G probably damaging Het
Other mutations in Ccr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01816:Ccr2 APN 9 124106198 missense probably benign
IGL02678:Ccr2 APN 9 124106746 missense probably benign 0.00
IGL02962:Ccr2 APN 9 124105675 splice site probably benign
IGL03330:Ccr2 APN 9 124105959 missense probably damaging 1.00
IGL03381:Ccr2 APN 9 124106372 missense probably benign 0.22
R0499:Ccr2 UTSW 9 124105939 missense possibly damaging 0.55
R0499:Ccr2 UTSW 9 124106126 missense possibly damaging 0.77
R0602:Ccr2 UTSW 9 124106621 missense probably benign 0.02
R0714:Ccr2 UTSW 9 124105929 missense probably benign
R1975:Ccr2 UTSW 9 124106793 missense probably benign 0.05
R4785:Ccr2 UTSW 9 124106372 missense probably benign 0.22
R5858:Ccr2 UTSW 9 124106427 missense probably benign 0.45
R5901:Ccr2 UTSW 9 124106202 missense possibly damaging 0.50
R6179:Ccr2 UTSW 9 124105971 missense probably damaging 1.00
R6933:Ccr2 UTSW 9 124106124 missense probably damaging 1.00
R7353:Ccr2 UTSW 9 124106756 missense probably damaging 1.00
R7575:Ccr2 UTSW 9 124105806 missense probably benign
X0026:Ccr2 UTSW 9 124105906 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTGGCCATCTCTGACCTG -3'
(R):5'- TGTGGAGAATTCCTGAGTAGCAG -3'

Sequencing Primer
(F):5'- GGCCATCTCTGACCTGCTCTTC -3'
(R):5'- GCAGGATCAGGCTCAAGATATTTCTC -3'
Posted On2019-10-17