Incidental Mutation 'R7515:Supv3l1'
ID582402
Institutional Source Beutler Lab
Gene Symbol Supv3l1
Ensembl Gene ENSMUSG00000020079
Gene Namesuppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7515 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location62429209-62449738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 62432311 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 585 (F585C)
Ref Sequence ENSEMBL: ENSMUSP00000020273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020273]
Predicted Effect probably damaging
Transcript: ENSMUST00000020273
AA Change: F585C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020273
Gene: ENSMUSG00000020079
AA Change: F585C

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 47 56 N/A INTRINSIC
HELICc 379 475 1.44e-18 SMART
Pfam:SUV3_C 625 672 4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162023
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit embryonic lethality between E9.5 and E12.5. Mice homozygous for a knock-out allele exhibit embryonic lethality between E8.5 and 9.5. Mice heterozygous for this allele produce offspring with mitochondrial defects regardless of offspring genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,628,905 E56D possibly damaging Het
Ankrd44 T C 1: 54,766,355 Y182C probably damaging Het
Anxa3 A T 5: 96,838,320 N273Y probably damaging Het
Apobec2 T C 17: 48,422,987 E217G probably damaging Het
Arhgap24 A G 5: 102,846,016 probably benign Het
Asap2 A G 12: 21,229,239 H374R possibly damaging Het
Camsap2 T C 1: 136,345,370 D23G probably damaging Het
Ccr2 T C 9: 124,106,160 V159A probably damaging Het
Cfap61 T A 2: 146,042,725 D614E unknown Het
Crb2 G A 2: 37,783,400 G103R probably damaging Het
Cyp2b9 A G 7: 26,199,171 Y317C probably damaging Het
Dhx36 A G 3: 62,472,087 V860A probably benign Het
Dnah3 T C 7: 120,073,592 D553G probably benign Het
Dnah7c T C 1: 46,457,290 S112P probably benign Het
Dnah9 A G 11: 65,841,414 F4222S probably benign Het
Ei24 T C 9: 36,789,915 D36G probably damaging Het
Etv3 G T 3: 87,528,056 R78L possibly damaging Het
Fbxo34 T C 14: 47,530,341 L437P possibly damaging Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Gabra1 T A 11: 42,154,833 D150V possibly damaging Het
Gpr158 T C 2: 21,368,281 L9P probably damaging Het
H2-M10.3 G A 17: 36,366,543 T281I probably damaging Het
Il18r1 T C 1: 40,498,670 S532P not run Het
Itpr2 T C 6: 146,327,110 D1329G probably damaging Het
Jakmip2 A T 18: 43,571,126 N384K probably benign Het
Kdsr A G 1: 106,734,560 V255A possibly damaging Het
Kifc1 A G 17: 33,884,803 L182P probably damaging Het
Lgals8 G A 13: 12,448,462 R198* probably null Het
Lrrk1 A T 7: 66,262,562 M1750K probably benign Het
Lrsam1 A G 2: 32,940,239 probably null Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Mcc G T 18: 44,493,432 H366N probably benign Het
Mif4gd A G 11: 115,608,396 V220A possibly damaging Het
Mtmr12 T A 15: 12,269,951 F708L probably damaging Het
Muc16 A T 9: 18,639,662 W5112R probably benign Het
Ndrg2 A G 14: 51,908,923 I140T probably benign Het
Nid2 C A 14: 19,791,567 Q887K probably benign Het
Nop16 A T 13: 54,589,737 S48T possibly damaging Het
Nrap G A 19: 56,366,427 T489I possibly damaging Het
Oas1e C T 5: 120,791,886 G189D probably damaging Het
Olfr1238 A G 2: 89,406,906 Y58H possibly damaging Het
Olfr854 A T 9: 19,566,653 C244S probably damaging Het
Pcdha5 A T 18: 36,962,118 D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phldb2 C T 16: 45,774,240 D901N possibly damaging Het
Piezo1 T C 8: 122,485,296 H2058R Het
Ptgis T A 2: 167,206,838 K419N possibly damaging Het
Ptprz1 T C 6: 23,022,267 F1714L probably damaging Het
Rasa2 T C 9: 96,552,300 probably null Het
Recql C T 6: 142,374,885 D146N probably damaging Het
Rnf6 T G 5: 146,211,792 S139R probably damaging Het
Rock1 A G 18: 10,067,631 S1301P probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Setd5 T A 6: 113,110,889 I137N probably damaging Het
Sf3b6 G A 12: 4,820,619 R19Q probably damaging Het
Slc15a5 T A 6: 138,043,498 H279L possibly damaging Het
Slc26a9 A G 1: 131,753,973 T175A probably damaging Het
Sspo A T 6: 48,493,886 N36I probably damaging Het
Tnrc6c G T 11: 117,741,681 V1070L probably benign Het
Vmn2r53 T A 7: 12,581,919 M658L probably benign Het
Zc3h13 A G 14: 75,308,909 D150G unknown Het
Zfp607b T C 7: 27,703,496 V459A probably benign Het
Zfp653 T C 9: 22,071,131 R71G probably damaging Het
Other mutations in Supv3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03067:Supv3l1 APN 10 62429821 missense probably damaging 1.00
R0090:Supv3l1 UTSW 10 62429706 missense probably benign 0.00
R0477:Supv3l1 UTSW 10 62430585 missense probably damaging 0.98
R0946:Supv3l1 UTSW 10 62429820 missense probably damaging 1.00
R1460:Supv3l1 UTSW 10 62443383 splice site probably benign
R1546:Supv3l1 UTSW 10 62432446 missense probably benign 0.08
R1941:Supv3l1 UTSW 10 62449612 missense probably benign
R3916:Supv3l1 UTSW 10 62449420 missense possibly damaging 0.67
R5030:Supv3l1 UTSW 10 62430615 missense probably damaging 1.00
R5040:Supv3l1 UTSW 10 62447065 missense possibly damaging 0.93
R5051:Supv3l1 UTSW 10 62443417 missense probably damaging 0.99
R5085:Supv3l1 UTSW 10 62435512 missense probably benign 0.00
R5288:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5359:Supv3l1 UTSW 10 62432399 missense probably damaging 0.96
R5372:Supv3l1 UTSW 10 62432357 missense probably damaging 0.99
R5384:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5385:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5527:Supv3l1 UTSW 10 62429829 missense probably damaging 1.00
R5602:Supv3l1 UTSW 10 62430592 missense possibly damaging 0.81
R5713:Supv3l1 UTSW 10 62430504 missense possibly damaging 0.91
R6150:Supv3l1 UTSW 10 62435722 missense possibly damaging 0.90
R6220:Supv3l1 UTSW 10 62439021 missense possibly damaging 0.82
R6903:Supv3l1 UTSW 10 62441237 missense probably damaging 1.00
R6941:Supv3l1 UTSW 10 62430586 missense possibly damaging 0.86
R7187:Supv3l1 UTSW 10 62435549 missense probably damaging 1.00
R7250:Supv3l1 UTSW 10 62445067 missense probably damaging 1.00
R7438:Supv3l1 UTSW 10 62430470 critical splice donor site probably null
R7439:Supv3l1 UTSW 10 62430615 missense probably damaging 0.99
R7579:Supv3l1 UTSW 10 62435708 missense probably damaging 1.00
R7579:Supv3l1 UTSW 10 62435709 missense possibly damaging 0.61
RF016:Supv3l1 UTSW 10 62437508 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGTCTCAGCTTACAATGGTGAC -3'
(R):5'- CCAGGCTGTCCAATGACTTC -3'

Sequencing Primer
(F):5'- GCCCAAATACAAGGCAAGGTTTTC -3'
(R):5'- GACTTCATTCTATTTCACCCCCAGG -3'
Posted On2019-10-17