Incidental Mutation 'R7515:Foxn1'
ID582406
Institutional Source Beutler Lab
Gene Symbol Foxn1
Ensembl Gene ENSMUSG00000002057
Gene Nameforkhead box N1
Synonymswhn, D11Bhm185e, Hfh11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7515 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location78357577-78386558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78371144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000103929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108294]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108294
AA Change: D133G

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103929
Gene: ENSMUSG00000002057
AA Change: D133G

DomainStartEndE-ValueType
FH 269 361 2.43e-45 SMART
low complexity region 392 409 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 558 586 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the forkhead family or "winged-helix" transcription factors that are important in developmental processes, immune system regulation, metabolism, cancer and aging. This gene family has over 100 members, subdivided into classes (A-Q) based on phylogeny. The encoded protein is proposed to regulate development of the thymus and differentiation of keratinocytes. Mutations in this gene cause severe primary T-cell immunodeficiency and congenital alopecia. In mouse mutations of this gene underlie the phenotype of the nude mouse, which has been widely used as a model system in oncology, immunology, dermatology, and transplantation studies. In humans mutations in this gene have been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for different mutations have in genetically determined absence or loss of hair and failed hair keratinization, premature lethality (differing by genetic background) and absence of thymus, resulting in multiple immune abnormalities. Heterozygotes have enlarged thymuses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,628,905 E56D possibly damaging Het
Ankrd44 T C 1: 54,766,355 Y182C probably damaging Het
Anxa3 A T 5: 96,838,320 N273Y probably damaging Het
Apobec2 T C 17: 48,422,987 E217G probably damaging Het
Arhgap24 A G 5: 102,846,016 probably benign Het
Asap2 A G 12: 21,229,239 H374R possibly damaging Het
Camsap2 T C 1: 136,345,370 D23G probably damaging Het
Ccr2 T C 9: 124,106,160 V159A probably damaging Het
Cfap61 T A 2: 146,042,725 D614E unknown Het
Crb2 G A 2: 37,783,400 G103R probably damaging Het
Cyp2b9 A G 7: 26,199,171 Y317C probably damaging Het
Dhx36 A G 3: 62,472,087 V860A probably benign Het
Dnah3 T C 7: 120,073,592 D553G probably benign Het
Dnah7c T C 1: 46,457,290 S112P probably benign Het
Dnah9 A G 11: 65,841,414 F4222S probably benign Het
Ei24 T C 9: 36,789,915 D36G probably damaging Het
Etv3 G T 3: 87,528,056 R78L possibly damaging Het
Fbxo34 T C 14: 47,530,341 L437P possibly damaging Het
Gabra1 T A 11: 42,154,833 D150V possibly damaging Het
Gpr158 T C 2: 21,368,281 L9P probably damaging Het
H2-M10.3 G A 17: 36,366,543 T281I probably damaging Het
Il18r1 T C 1: 40,498,670 S532P not run Het
Itpr2 T C 6: 146,327,110 D1329G probably damaging Het
Jakmip2 A T 18: 43,571,126 N384K probably benign Het
Kdsr A G 1: 106,734,560 V255A possibly damaging Het
Kifc1 A G 17: 33,884,803 L182P probably damaging Het
Lgals8 G A 13: 12,448,462 R198* probably null Het
Lrrk1 A T 7: 66,262,562 M1750K probably benign Het
Lrsam1 A G 2: 32,940,239 probably null Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Mcc G T 18: 44,493,432 H366N probably benign Het
Mif4gd A G 11: 115,608,396 V220A possibly damaging Het
Mtmr12 T A 15: 12,269,951 F708L probably damaging Het
Muc16 A T 9: 18,639,662 W5112R probably benign Het
Ndrg2 A G 14: 51,908,923 I140T probably benign Het
Nid2 C A 14: 19,791,567 Q887K probably benign Het
Nop16 A T 13: 54,589,737 S48T possibly damaging Het
Nrap G A 19: 56,366,427 T489I possibly damaging Het
Oas1e C T 5: 120,791,886 G189D probably damaging Het
Olfr1238 A G 2: 89,406,906 Y58H possibly damaging Het
Olfr854 A T 9: 19,566,653 C244S probably damaging Het
Pcdha5 A T 18: 36,962,118 D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phldb2 C T 16: 45,774,240 D901N possibly damaging Het
Piezo1 T C 8: 122,485,296 H2058R Het
Ptgis T A 2: 167,206,838 K419N possibly damaging Het
Ptprz1 T C 6: 23,022,267 F1714L probably damaging Het
Rasa2 T C 9: 96,552,300 probably null Het
Recql C T 6: 142,374,885 D146N probably damaging Het
Rnf6 T G 5: 146,211,792 S139R probably damaging Het
Rock1 A G 18: 10,067,631 S1301P probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Setd5 T A 6: 113,110,889 I137N probably damaging Het
Sf3b6 G A 12: 4,820,619 R19Q probably damaging Het
Slc15a5 T A 6: 138,043,498 H279L possibly damaging Het
Slc26a9 A G 1: 131,753,973 T175A probably damaging Het
Sspo A T 6: 48,493,886 N36I probably damaging Het
Supv3l1 A C 10: 62,432,311 F585C probably damaging Het
Tnrc6c G T 11: 117,741,681 V1070L probably benign Het
Vmn2r53 T A 7: 12,581,919 M658L probably benign Het
Zc3h13 A G 14: 75,308,909 D150G unknown Het
Zfp607b T C 7: 27,703,496 V459A probably benign Het
Zfp653 T C 9: 22,071,131 R71G probably damaging Het
Other mutations in Foxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Foxn1 APN 11 78371283 missense probably benign 0.24
IGL01391:Foxn1 APN 11 78361494 missense probably damaging 1.00
IGL01737:Foxn1 APN 11 78360906 missense possibly damaging 0.81
IGL02669:Foxn1 APN 11 78371160 missense probably damaging 0.99
IGL03276:Foxn1 APN 11 78371124 missense probably benign 0.16
R0200:Foxn1 UTSW 11 78361040 missense probably damaging 1.00
R0639:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R0739:Foxn1 UTSW 11 78358999 missense probably benign 0.01
R1112:Foxn1 UTSW 11 78371030 missense probably benign 0.29
R1167:Foxn1 UTSW 11 78359066 missense probably damaging 0.99
R1251:Foxn1 UTSW 11 78358785 missense probably damaging 0.99
R1474:Foxn1 UTSW 11 78361107 missense probably benign
R1506:Foxn1 UTSW 11 78365935 splice site probably benign
R1616:Foxn1 UTSW 11 78358866 missense probably benign 0.00
R1795:Foxn1 UTSW 11 78371225 missense probably benign 0.01
R1905:Foxn1 UTSW 11 78371810 splice site probably null
R1906:Foxn1 UTSW 11 78371810 splice site probably null
R1975:Foxn1 UTSW 11 78365937 splice site probably benign
R1976:Foxn1 UTSW 11 78365937 splice site probably benign
R2206:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2207:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2988:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R2989:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R5015:Foxn1 UTSW 11 78371163 missense probably damaging 1.00
R5140:Foxn1 UTSW 11 78361633 missense probably benign 0.18
R5533:Foxn1 UTSW 11 78365966 missense probably damaging 1.00
R6712:Foxn1 UTSW 11 78361259 missense probably damaging 1.00
R6852:Foxn1 UTSW 11 78360960 missense probably benign 0.00
R7176:Foxn1 UTSW 11 78360867 missense possibly damaging 0.94
R7331:Foxn1 UTSW 11 78358789 missense probably damaging 1.00
R7562:Foxn1 UTSW 11 78371132 missense probably damaging 1.00
R7657:Foxn1 UTSW 11 78365964 missense probably benign 0.29
R8838:Foxn1 UTSW 11 78361612 missense possibly damaging 0.52
X0067:Foxn1 UTSW 11 78361542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTTCTAGGCAGCTAGGAG -3'
(R):5'- CTAACTTCAGCTGCTCGTCG -3'

Sequencing Primer
(F):5'- TCTTTCTAGGCAGCTAGGAGAGAGG -3'
(R):5'- CTCGTCGTTTGTGCCTGACG -3'
Posted On2019-10-17