Incidental Mutation 'R7515:Fbxo34'
ID582414
Institutional Source Beutler Lab
Gene Symbol Fbxo34
Ensembl Gene ENSMUSG00000037536
Gene NameF-box protein 34
Synonyms5830426G16Rik, 2900057B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7515 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location47450421-47531962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47530341 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 437 (L437P)
Ref Sequence ENSEMBL: ENSMUSP00000044675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043112] [ENSMUST00000095941] [ENSMUST00000163324] [ENSMUST00000165714] [ENSMUST00000168833] [ENSMUST00000226395] [ENSMUST00000226432] [ENSMUST00000226954] [ENSMUST00000228019] [ENSMUST00000228668] [ENSMUST00000228740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043112
AA Change: L437P

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044675
Gene: ENSMUSG00000037536
AA Change: L437P

DomainStartEndE-ValueType
low complexity region 8 45 N/A INTRINSIC
FBOX 613 653 1.84e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095941
AA Change: L386P

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093634
Gene: ENSMUSG00000037536
AA Change: L386P

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163324
AA Change: L386P

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131708
Gene: ENSMUSG00000037536
AA Change: L386P

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165714
AA Change: L386P

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130036
Gene: ENSMUSG00000037536
AA Change: L386P

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168833
AA Change: L386P

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132271
Gene: ENSMUSG00000037536
AA Change: L386P

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226395
Predicted Effect probably benign
Transcript: ENSMUST00000226432
Predicted Effect probably benign
Transcript: ENSMUST00000226954
Predicted Effect probably benign
Transcript: ENSMUST00000227601
Predicted Effect probably benign
Transcript: ENSMUST00000228019
Predicted Effect probably benign
Transcript: ENSMUST00000228668
Predicted Effect probably benign
Transcript: ENSMUST00000228740
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO34, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,628,905 E56D possibly damaging Het
Ankrd44 T C 1: 54,766,355 Y182C probably damaging Het
Anxa3 A T 5: 96,838,320 N273Y probably damaging Het
Apobec2 T C 17: 48,422,987 E217G probably damaging Het
Arhgap24 A G 5: 102,846,016 probably benign Het
Asap2 A G 12: 21,229,239 H374R possibly damaging Het
Camsap2 T C 1: 136,345,370 D23G probably damaging Het
Ccr2 T C 9: 124,106,160 V159A probably damaging Het
Cfap61 T A 2: 146,042,725 D614E unknown Het
Crb2 G A 2: 37,783,400 G103R probably damaging Het
Cyp2b9 A G 7: 26,199,171 Y317C probably damaging Het
Dhx36 A G 3: 62,472,087 V860A probably benign Het
Dnah3 T C 7: 120,073,592 D553G probably benign Het
Dnah7c T C 1: 46,457,290 S112P probably benign Het
Dnah9 A G 11: 65,841,414 F4222S probably benign Het
Ei24 T C 9: 36,789,915 D36G probably damaging Het
Etv3 G T 3: 87,528,056 R78L possibly damaging Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Gabra1 T A 11: 42,154,833 D150V possibly damaging Het
Gpr158 T C 2: 21,368,281 L9P probably damaging Het
H2-M10.3 G A 17: 36,366,543 T281I probably damaging Het
Il18r1 T C 1: 40,498,670 S532P not run Het
Itpr2 T C 6: 146,327,110 D1329G probably damaging Het
Jakmip2 A T 18: 43,571,126 N384K probably benign Het
Kdsr A G 1: 106,734,560 V255A possibly damaging Het
Kifc1 A G 17: 33,884,803 L182P probably damaging Het
Lgals8 G A 13: 12,448,462 R198* probably null Het
Lrrk1 A T 7: 66,262,562 M1750K probably benign Het
Lrsam1 A G 2: 32,940,239 probably null Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Mcc G T 18: 44,493,432 H366N probably benign Het
Mif4gd A G 11: 115,608,396 V220A possibly damaging Het
Mtmr12 T A 15: 12,269,951 F708L probably damaging Het
Muc16 A T 9: 18,639,662 W5112R probably benign Het
Ndrg2 A G 14: 51,908,923 I140T probably benign Het
Nid2 C A 14: 19,791,567 Q887K probably benign Het
Nop16 A T 13: 54,589,737 S48T possibly damaging Het
Nrap G A 19: 56,366,427 T489I possibly damaging Het
Oas1e C T 5: 120,791,886 G189D probably damaging Het
Olfr1238 A G 2: 89,406,906 Y58H possibly damaging Het
Olfr854 A T 9: 19,566,653 C244S probably damaging Het
Pcdha5 A T 18: 36,962,118 D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Phldb2 C T 16: 45,774,240 D901N possibly damaging Het
Piezo1 T C 8: 122,485,296 H2058R Het
Ptgis T A 2: 167,206,838 K419N possibly damaging Het
Ptprz1 T C 6: 23,022,267 F1714L probably damaging Het
Rasa2 T C 9: 96,552,300 probably null Het
Recql C T 6: 142,374,885 D146N probably damaging Het
Rnf6 T G 5: 146,211,792 S139R probably damaging Het
Rock1 A G 18: 10,067,631 S1301P probably damaging Het
Safb2 A G 17: 56,582,982 probably null Het
Setd5 T A 6: 113,110,889 I137N probably damaging Het
Sf3b6 G A 12: 4,820,619 R19Q probably damaging Het
Slc15a5 T A 6: 138,043,498 H279L possibly damaging Het
Slc26a9 A G 1: 131,753,973 T175A probably damaging Het
Sspo A T 6: 48,493,886 N36I probably damaging Het
Supv3l1 A C 10: 62,432,311 F585C probably damaging Het
Tnrc6c G T 11: 117,741,681 V1070L probably benign Het
Vmn2r53 T A 7: 12,581,919 M658L probably benign Het
Zc3h13 A G 14: 75,308,909 D150G unknown Het
Zfp607b T C 7: 27,703,496 V459A probably benign Het
Zfp653 T C 9: 22,071,131 R71G probably damaging Het
Other mutations in Fbxo34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Fbxo34 APN 14 47529474 missense probably damaging 0.97
IGL01337:Fbxo34 APN 14 47530217 missense probably benign 0.05
IGL01418:Fbxo34 APN 14 47530784 missense possibly damaging 0.46
IGL02069:Fbxo34 APN 14 47529613 missense probably damaging 1.00
IGL02829:Fbxo34 APN 14 47529689 missense probably benign 0.00
R0601:Fbxo34 UTSW 14 47530257 missense probably benign
R0714:Fbxo34 UTSW 14 47530029 missense probably damaging 1.00
R1186:Fbxo34 UTSW 14 47530586 missense probably damaging 0.99
R1714:Fbxo34 UTSW 14 47529201 missense probably damaging 1.00
R1842:Fbxo34 UTSW 14 47531007 missense probably damaging 0.98
R2127:Fbxo34 UTSW 14 47530106 missense probably damaging 0.98
R4199:Fbxo34 UTSW 14 47530997 missense probably damaging 1.00
R4649:Fbxo34 UTSW 14 47529628 missense probably damaging 1.00
R4801:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4802:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4906:Fbxo34 UTSW 14 47529454 missense probably benign 0.26
R5475:Fbxo34 UTSW 14 47529345 missense probably benign 0.01
R5888:Fbxo34 UTSW 14 47529719 missense probably damaging 0.98
R6573:Fbxo34 UTSW 14 47529667 missense possibly damaging 0.61
R7236:Fbxo34 UTSW 14 47530384 missense probably benign 0.00
R7257:Fbxo34 UTSW 14 47500872 critical splice donor site probably null
R7381:Fbxo34 UTSW 14 47530535 missense probably benign 0.02
R7562:Fbxo34 UTSW 14 47529678 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCTCACTAATGGTTCTCAGG -3'
(R):5'- TCTACCGTGCACACAGTGATG -3'

Sequencing Primer
(F):5'- ACTAATGGTTCTCAGGCCAGC -3'
(R):5'- TTCTTATGCGACGGACAG -3'
Posted On2019-10-17