Incidental Mutation 'R0008:Sdk2'
ID 58242
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Name sidekick cell adhesion molecule 2
Synonyms 4632412F08Rik, 5330435L01Rik
MMRRC Submission 038303-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R0008 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 113667200-113957855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113747581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 643 (L643P)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627] [ENSMUST00000141943]
AlphaFold Q6V4S5
Predicted Effect probably damaging
Transcript: ENSMUST00000041627
AA Change: L643P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: L643P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141943
AA Change: L643P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116872
Gene: ENSMUSG00000041592
AA Change: L643P

DomainStartEndE-ValueType
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 889 1.96e1 SMART
Meta Mutation Damage Score 0.2628 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 137,882,346 (GRCm39) K118R possibly damaging Het
Adtrp T C 13: 41,920,941 (GRCm39) T88A probably damaging Het
Afap1l1 A G 18: 61,889,976 (GRCm39) S87P probably benign Het
Ankrd27 A G 7: 35,303,125 (GRCm39) K196R probably benign Het
Apoe G A 7: 19,431,005 (GRCm39) T79M probably damaging Het
Arrdc3 T A 13: 81,032,011 (GRCm39) Y81* probably null Het
Arrdc3 T A 13: 81,039,194 (GRCm39) I75N probably damaging Het
Asah2 T A 19: 31,981,131 (GRCm39) K629* probably null Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
C130074G19Rik A G 1: 184,615,119 (GRCm39) S24P probably benign Het
C87436 A G 6: 86,423,265 (GRCm39) probably benign Het
Calcrl T C 2: 84,203,618 (GRCm39) D54G probably benign Het
Clcn2 T C 16: 20,529,140 (GRCm39) N367S probably null Het
Cnot1 G T 8: 96,487,969 (GRCm39) D562E probably damaging Het
Commd6 G A 14: 101,877,709 (GRCm39) probably benign Het
Cox6a2 G A 7: 127,805,212 (GRCm39) probably benign Het
Cp T A 3: 20,022,287 (GRCm39) Y230N probably damaging Het
Dclre1c T C 2: 3,439,032 (GRCm39) V64A probably damaging Het
Eng T C 2: 32,567,692 (GRCm39) V110A probably damaging Het
Esyt3 T C 9: 99,220,860 (GRCm39) I114M possibly damaging Het
Fam83h A T 15: 75,875,811 (GRCm39) Y509N probably damaging Het
Fat2 A T 11: 55,202,075 (GRCm39) L333H probably damaging Het
Fbxo21 A G 5: 118,146,078 (GRCm39) N567S possibly damaging Het
Fcsk T C 8: 111,610,865 (GRCm39) probably benign Het
Fn1 A T 1: 71,634,879 (GRCm39) L1964Q probably damaging Het
Gorasp1 G T 9: 119,757,312 (GRCm39) S353R possibly damaging Het
Grk2 C T 19: 4,337,262 (GRCm39) E646K probably damaging Het
Hoxc11 T C 15: 102,863,397 (GRCm39) V146A probably damaging Het
Igf2bp2 T C 16: 21,894,841 (GRCm39) T301A probably benign Het
Il11 T C 7: 4,776,658 (GRCm39) S111G probably benign Het
Ist1 A T 8: 110,403,418 (GRCm39) I273K probably benign Het
Kdm2b G A 5: 123,019,806 (GRCm39) S738L probably benign Het
Lrp2 T A 2: 69,346,895 (GRCm39) N784Y probably benign Het
Lrp6 T C 6: 134,462,716 (GRCm39) E648G probably damaging Het
Mapk15 G A 15: 75,870,103 (GRCm39) E408K probably benign Het
Mdn1 T A 4: 32,718,317 (GRCm39) F2191I possibly damaging Het
Metrn C A 17: 26,015,479 (GRCm39) V79F possibly damaging Het
Mtbp T A 15: 55,449,889 (GRCm39) probably benign Het
Myh11 C A 16: 14,041,883 (GRCm39) Q720H probably damaging Het
Myo3a T A 2: 22,469,753 (GRCm39) I508N probably damaging Het
Nat9 A T 11: 115,075,941 (GRCm39) Y27N probably damaging Het
Ncapg2 T C 12: 116,393,455 (GRCm39) F553S probably damaging Het
Nipsnap3b T A 4: 53,015,112 (GRCm39) L53Q probably damaging Het
Nlrp3 A T 11: 59,449,274 (GRCm39) H852L probably benign Het
Or2d3b A G 7: 106,514,226 (GRCm39) I274V probably benign Het
Or2t6 T A 14: 14,176,092 (GRCm38) probably benign Het
Or4a78 T A 2: 89,497,428 (GRCm39) K267N probably damaging Het
Or52e3 A T 7: 102,869,558 (GRCm39) D211V probably damaging Het
Or52e3 G A 7: 102,869,584 (GRCm39) A220T probably benign Het
Or5b122 A G 19: 13,563,240 (GRCm39) I191V probably benign Het
Pax9 A G 12: 56,756,528 (GRCm39) T289A probably benign Het
Pcyt2 A T 11: 120,506,695 (GRCm39) I53N possibly damaging Het
Pdlim4 C T 11: 53,945,875 (GRCm39) V327M probably damaging Het
Pdzph1 T A 17: 59,229,756 (GRCm39) probably benign Het
Plekhm2 C T 4: 141,369,704 (GRCm39) probably benign Het
Ppt1 T C 4: 122,742,216 (GRCm39) probably benign Het
Prdm1 C T 10: 44,317,675 (GRCm39) E398K probably damaging Het
Prep T C 10: 44,991,174 (GRCm39) V280A probably benign Het
Prkdc T A 16: 15,526,565 (GRCm39) probably benign Het
Proser3 G A 7: 30,239,563 (GRCm39) R514C probably damaging Het
Ptk7 G A 17: 46,883,688 (GRCm39) probably benign Het
Rbm45 T C 2: 76,208,742 (GRCm39) Y293H probably damaging Het
Rnf213 A C 11: 119,355,878 (GRCm39) E4108A possibly damaging Het
Sec24d C A 3: 123,144,525 (GRCm39) probably benign Het
Sh2d3c C G 2: 32,643,033 (GRCm39) H587D probably damaging Het
Slc1a1 G A 19: 28,878,884 (GRCm39) G208S probably benign Het
Slc35b4 A T 6: 34,135,452 (GRCm39) Y287N probably damaging Het
Slc46a2 T A 4: 59,914,544 (GRCm39) L126F probably damaging Het
Slc4a8 T C 15: 100,698,374 (GRCm39) M621T possibly damaging Het
Slc9b2 T A 3: 135,042,269 (GRCm39) V516D possibly damaging Het
Slco1a6 T A 6: 142,102,948 (GRCm39) probably benign Het
Sncg C T 14: 34,096,495 (GRCm39) V15I probably benign Het
Srgap2 T C 1: 131,283,302 (GRCm39) T260A probably damaging Het
Stk10 T A 11: 32,537,305 (GRCm39) probably benign Het
Taf5 A G 19: 47,064,301 (GRCm39) S415G possibly damaging Het
Tdp1 C T 12: 99,921,217 (GRCm39) probably benign Het
Tdp2 T G 13: 25,025,333 (GRCm39) probably null Het
Tgfbi T A 13: 56,777,587 (GRCm39) I357N probably benign Het
Tmem116 A G 5: 121,633,159 (GRCm39) T178A probably damaging Het
Tnrc6a G A 7: 122,769,617 (GRCm39) R469H probably benign Het
Top2a A T 11: 98,893,729 (GRCm39) L1055* probably null Het
Tox T A 4: 6,842,411 (GRCm39) M40L probably benign Het
Trib2 A T 12: 15,859,930 (GRCm39) H110Q probably benign Het
Trpa1 A G 1: 14,973,439 (GRCm39) I293T possibly damaging Het
Trpv2 A G 11: 62,481,086 (GRCm39) Y395C probably damaging Het
Ubn2 T A 6: 38,411,535 (GRCm39) probably null Het
Ubr4 C T 4: 139,157,487 (GRCm39) T2348M probably damaging Het
Ubxn4 G A 1: 128,190,641 (GRCm39) E256K probably benign Het
Vmn1r33 C A 6: 66,589,510 (GRCm39) G15* probably null Het
Vmn1r37 T A 6: 66,708,769 (GRCm39) S95T probably benign Het
Vmn2r57 A G 7: 41,050,076 (GRCm39) C558R probably damaging Het
Vnn1 T C 10: 23,774,500 (GRCm39) probably null Het
Vps13c T C 9: 67,826,544 (GRCm39) V1395A probably benign Het
Vwa7 A G 17: 35,238,781 (GRCm39) I290V probably benign Het
Wdr93 A G 7: 79,408,221 (GRCm39) E234G probably damaging Het
Zfp385b A T 2: 77,246,291 (GRCm39) S245R probably benign Het
Zfp942 A T 17: 22,147,319 (GRCm39) C437S probably damaging Het
Zfyve9 T A 4: 108,575,902 (GRCm39) E393V possibly damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113,745,210 (GRCm39) missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113,721,668 (GRCm39) missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113,733,906 (GRCm39) missense probably benign
IGL01316:Sdk2 APN 11 113,758,791 (GRCm39) missense probably benign 0.09
IGL01614:Sdk2 APN 11 113,684,684 (GRCm39) missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113,729,358 (GRCm39) missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113,729,320 (GRCm39) missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113,725,656 (GRCm39) missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113,725,639 (GRCm39) splice site probably benign
IGL02543:Sdk2 APN 11 113,759,747 (GRCm39) missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113,742,668 (GRCm39) missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113,712,452 (GRCm39) missense probably benign 0.00
IGL03122:Sdk2 APN 11 113,732,894 (GRCm39) missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113,741,810 (GRCm39) missense probably benign 0.19
IGL03222:Sdk2 APN 11 113,729,257 (GRCm39) missense probably benign 0.01
IGL03310:Sdk2 APN 11 113,684,151 (GRCm39) missense possibly damaging 0.77
Curtailed UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
Trimmed UTSW 11 113,747,522 (GRCm39) nonsense probably null
ANU05:Sdk2 UTSW 11 113,733,906 (GRCm39) missense probably benign
BB008:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113,717,912 (GRCm39) missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0386:Sdk2 UTSW 11 113,784,290 (GRCm39) missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113,720,793 (GRCm39) missense probably benign 0.04
R0409:Sdk2 UTSW 11 113,741,717 (GRCm39) splice site probably benign
R0416:Sdk2 UTSW 11 113,694,029 (GRCm39) missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113,682,292 (GRCm39) missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113,671,836 (GRCm39) missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113,685,746 (GRCm39) splice site probably null
R0711:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0717:Sdk2 UTSW 11 113,723,152 (GRCm39) missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R0831:Sdk2 UTSW 11 113,723,084 (GRCm39) missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113,712,241 (GRCm39) missense probably benign 0.00
R0865:Sdk2 UTSW 11 113,741,748 (GRCm39) missense probably benign 0.12
R0930:Sdk2 UTSW 11 113,729,271 (GRCm39) missense probably benign 0.01
R0964:Sdk2 UTSW 11 113,697,243 (GRCm39) splice site probably benign
R1051:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1052:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1054:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1055:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1077:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1079:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1115:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1186:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1187:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1337:Sdk2 UTSW 11 113,723,157 (GRCm39) missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1433:Sdk2 UTSW 11 113,685,871 (GRCm39) missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113,784,401 (GRCm39) splice site probably benign
R1514:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1529:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1596:Sdk2 UTSW 11 113,729,435 (GRCm39) splice site probably benign
R1680:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1680:Sdk2 UTSW 11 113,682,262 (GRCm39) missense possibly damaging 0.47
R1770:Sdk2 UTSW 11 113,684,567 (GRCm39) missense probably benign 0.05
R1858:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1866:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1874:Sdk2 UTSW 11 113,725,782 (GRCm39) missense probably benign 0.00
R1899:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1905:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1907:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1913:Sdk2 UTSW 11 113,747,552 (GRCm39) missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113,671,843 (GRCm39) nonsense probably null
R2055:Sdk2 UTSW 11 113,741,780 (GRCm39) missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113,745,158 (GRCm39) missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113,833,948 (GRCm39) missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113,721,620 (GRCm39) missense probably benign 0.44
R3720:Sdk2 UTSW 11 113,691,070 (GRCm39) missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113,747,522 (GRCm39) nonsense probably null
R4037:Sdk2 UTSW 11 113,685,881 (GRCm39) missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113,757,815 (GRCm39) splice site probably null
R4717:Sdk2 UTSW 11 113,745,195 (GRCm39) missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113,717,880 (GRCm39) missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113,712,208 (GRCm39) nonsense probably null
R4924:Sdk2 UTSW 11 113,748,584 (GRCm39) missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113,684,587 (GRCm39) missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113,741,808 (GRCm39) missense probably benign 0.01
R5239:Sdk2 UTSW 11 113,758,859 (GRCm39) missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113,715,912 (GRCm39) missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113,757,857 (GRCm39) missense probably benign 0.31
R5535:Sdk2 UTSW 11 113,833,984 (GRCm39) missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113,742,540 (GRCm39) missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113,724,005 (GRCm39) missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113,759,778 (GRCm39) missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113,717,942 (GRCm39) missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113,745,099 (GRCm39) missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113,725,810 (GRCm39) missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113,742,708 (GRCm39) missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113,720,885 (GRCm39) missense probably benign 0.00
R5953:Sdk2 UTSW 11 113,684,570 (GRCm39) missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113,834,080 (GRCm39) missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113,720,889 (GRCm39) missense probably benign 0.00
R6116:Sdk2 UTSW 11 113,745,190 (GRCm39) missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113,684,581 (GRCm39) missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R6383:Sdk2 UTSW 11 113,723,091 (GRCm39) missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113,758,760 (GRCm39) missense probably benign 0.43
R6835:Sdk2 UTSW 11 113,720,874 (GRCm39) missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113,671,755 (GRCm39) missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113,793,946 (GRCm39) missense probably benign 0.03
R7000:Sdk2 UTSW 11 113,693,995 (GRCm39) missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113,725,731 (GRCm39) missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113,733,516 (GRCm39) nonsense probably null
R7177:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113,729,315 (GRCm39) missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113,758,909 (GRCm39) splice site probably null
R7504:Sdk2 UTSW 11 113,758,793 (GRCm39) missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113,764,039 (GRCm39) missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113,684,563 (GRCm39) missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113,764,027 (GRCm39) missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113,750,764 (GRCm39) missense probably benign 0.18
R8052:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113,717,915 (GRCm39) missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113,742,539 (GRCm39) missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113,763,683 (GRCm39) missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113,729,542 (GRCm39) missense probably benign
R8715:Sdk2 UTSW 11 113,671,728 (GRCm39) missense probably damaging 1.00
R8774:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113,763,978 (GRCm39) nonsense probably null
R9136:Sdk2 UTSW 11 113,697,203 (GRCm39) missense probably damaging 1.00
R9147:Sdk2 UTSW 11 113,714,226 (GRCm39) missense probably benign 0.18
R9300:Sdk2 UTSW 11 113,715,856 (GRCm39) missense possibly damaging 0.63
R9354:Sdk2 UTSW 11 113,725,757 (GRCm39) missense probably benign 0.00
R9450:Sdk2 UTSW 11 113,697,105 (GRCm39) missense probably benign
R9462:Sdk2 UTSW 11 113,760,744 (GRCm39) missense possibly damaging 0.56
R9616:Sdk2 UTSW 11 113,691,061 (GRCm39) missense probably benign 0.05
R9678:Sdk2 UTSW 11 113,685,789 (GRCm39) nonsense probably null
RF002:Sdk2 UTSW 11 113,776,078 (GRCm39) missense probably benign 0.00
V1662:Sdk2 UTSW 11 113,725,734 (GRCm39) missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113,742,662 (GRCm39) missense probably damaging 0.97
Z1176:Sdk2 UTSW 11 113,730,148 (GRCm39) missense probably benign 0.41
Z1177:Sdk2 UTSW 11 113,750,782 (GRCm39) missense probably benign
Z1177:Sdk2 UTSW 11 113,730,146 (GRCm39) missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113,729,485 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCACAGGATGCTGCCTTTTC -3'
(R):5'- AGCTGACATGGTGACCTATGCTGC -3'

Sequencing Primer
(F):5'- CATTCTACAGAGTGGAAGACTGAG -3'
(R):5'- tgccaagcctgatgacc -3'
Posted On 2013-07-11