Incidental Mutation 'R7515:Jakmip2'
ID 582426
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission 045588-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.316) question?
Stock # R7515 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 43664472-43820838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43704191 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 384 (N384K)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably benign
Transcript: ENSMUST00000082254
AA Change: N384K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: N384K

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 A T 11: 5,578,905 (GRCm39) E56D possibly damaging Het
Ankrd44 T C 1: 54,805,514 (GRCm39) Y182C probably damaging Het
Anxa3 A T 5: 96,986,179 (GRCm39) N273Y probably damaging Het
Apobec2 T C 17: 48,730,015 (GRCm39) E217G probably damaging Het
Arhgap24 A G 5: 102,993,882 (GRCm39) probably benign Het
Asap2 A G 12: 21,279,240 (GRCm39) H374R possibly damaging Het
Camsap2 T C 1: 136,273,108 (GRCm39) D23G probably damaging Het
Ccr2 T C 9: 123,906,197 (GRCm39) V159A probably damaging Het
Cfap61 T A 2: 145,884,645 (GRCm39) D614E unknown Het
Crb2 G A 2: 37,673,412 (GRCm39) G103R probably damaging Het
Cyp2b9 A G 7: 25,898,596 (GRCm39) Y317C probably damaging Het
Dhx36 A G 3: 62,379,508 (GRCm39) V860A probably benign Het
Dnah3 T C 7: 119,672,815 (GRCm39) D553G probably benign Het
Dnah7c T C 1: 46,496,450 (GRCm39) S112P probably benign Het
Dnah9 A G 11: 65,732,240 (GRCm39) F4222S probably benign Het
Ei24 T C 9: 36,701,211 (GRCm39) D36G probably damaging Het
Etv3 G T 3: 87,435,363 (GRCm39) R78L possibly damaging Het
Fbxo34 T C 14: 47,767,798 (GRCm39) L437P possibly damaging Het
Foxn1 T C 11: 78,261,970 (GRCm39) D133G possibly damaging Het
Gabra1 T A 11: 42,045,660 (GRCm39) D150V possibly damaging Het
Gpr158 T C 2: 21,373,092 (GRCm39) L9P probably damaging Het
H2-M10.3 G A 17: 36,677,435 (GRCm39) T281I probably damaging Het
Il18r1 T C 1: 40,537,830 (GRCm39) S532P not run Het
Itpr2 T C 6: 146,228,608 (GRCm39) D1329G probably damaging Het
Kdsr A G 1: 106,662,290 (GRCm39) V255A possibly damaging Het
Kifc1 A G 17: 34,103,777 (GRCm39) L182P probably damaging Het
Lgals8 G A 13: 12,463,343 (GRCm39) R198* probably null Het
Lrrk1 A T 7: 65,912,310 (GRCm39) M1750K probably benign Het
Lrsam1 A G 2: 32,830,251 (GRCm39) probably null Het
Lztr1 C T 16: 17,327,525 (GRCm39) A76V possibly damaging Het
Mcc G T 18: 44,626,499 (GRCm39) H366N probably benign Het
Mif4gd A G 11: 115,499,222 (GRCm39) V220A possibly damaging Het
Mtmr12 T A 15: 12,270,037 (GRCm39) F708L probably damaging Het
Muc16 A T 9: 18,550,958 (GRCm39) W5112R probably benign Het
Ndrg2 A G 14: 52,146,380 (GRCm39) I140T probably benign Het
Nid2 C A 14: 19,841,635 (GRCm39) Q887K probably benign Het
Nop16 A T 13: 54,737,550 (GRCm39) S48T possibly damaging Het
Nrap G A 19: 56,354,859 (GRCm39) T489I possibly damaging Het
Oas1e C T 5: 120,929,951 (GRCm39) G189D probably damaging Het
Or4a39 A G 2: 89,237,250 (GRCm39) Y58H possibly damaging Het
Or7g34 A T 9: 19,477,949 (GRCm39) C244S probably damaging Het
Pcdha5 A T 18: 37,095,171 (GRCm39) D560V probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phldb2 C T 16: 45,594,603 (GRCm39) D901N possibly damaging Het
Piezo1 T C 8: 123,212,035 (GRCm39) H2058R Het
Ptgis T A 2: 167,048,758 (GRCm39) K419N possibly damaging Het
Ptprz1 T C 6: 23,022,266 (GRCm39) F1714L probably damaging Het
Rasa2 T C 9: 96,434,353 (GRCm39) probably null Het
Recql C T 6: 142,320,611 (GRCm39) D146N probably damaging Het
Rnf6 T G 5: 146,148,602 (GRCm39) S139R probably damaging Het
Rock1 A G 18: 10,067,631 (GRCm39) S1301P probably damaging Het
Safb2 A G 17: 56,889,982 (GRCm39) probably null Het
Setd5 T A 6: 113,087,850 (GRCm39) I137N probably damaging Het
Sf3b6 G A 12: 4,870,619 (GRCm39) R19Q probably damaging Het
Slc15a5 T A 6: 138,020,496 (GRCm39) H279L possibly damaging Het
Slc26a9 A G 1: 131,681,711 (GRCm39) T175A probably damaging Het
Sspo A T 6: 48,470,820 (GRCm39) N36I probably damaging Het
Supv3l1 A C 10: 62,268,090 (GRCm39) F585C probably damaging Het
Tnrc6c G T 11: 117,632,507 (GRCm39) V1070L probably benign Het
Vmn2r53 T A 7: 12,315,846 (GRCm39) M658L probably benign Het
Zc3h13 A G 14: 75,546,349 (GRCm39) D150G unknown Het
Zfp607b T C 7: 27,402,921 (GRCm39) V459A probably benign Het
Zfp653 T C 9: 21,982,427 (GRCm39) R71G probably damaging Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43,723,744 (GRCm39) utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43,690,389 (GRCm39) splice site probably benign
IGL01467:Jakmip2 APN 18 43,715,352 (GRCm39) missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43,680,159 (GRCm39) missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43,692,158 (GRCm39) critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43,704,919 (GRCm39) missense probably benign
IGL02143:Jakmip2 APN 18 43,696,350 (GRCm39) missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43,700,223 (GRCm39) missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43,695,655 (GRCm39) missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43,708,516 (GRCm39) splice site probably benign
IGL02866:Jakmip2 APN 18 43,685,266 (GRCm39) missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43,695,595 (GRCm39) critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43,685,210 (GRCm39) splice site probably benign
R0044:Jakmip2 UTSW 18 43,715,170 (GRCm39) missense probably benign
R0436:Jakmip2 UTSW 18 43,691,234 (GRCm39) nonsense probably null
R1453:Jakmip2 UTSW 18 43,692,279 (GRCm39) splice site probably null
R1682:Jakmip2 UTSW 18 43,714,896 (GRCm39) critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43,715,145 (GRCm39) missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43,700,209 (GRCm39) missense probably benign
R2070:Jakmip2 UTSW 18 43,696,395 (GRCm39) missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43,698,995 (GRCm39) missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43,704,246 (GRCm39) missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43,682,751 (GRCm39) missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43,695,657 (GRCm39) missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43,710,477 (GRCm39) missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43,700,208 (GRCm39) missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43,710,465 (GRCm39) missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43,701,173 (GRCm39) missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43,715,025 (GRCm39) missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43,692,181 (GRCm39) missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43,715,059 (GRCm39) missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43,708,599 (GRCm39) missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43,704,244 (GRCm39) missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43,689,589 (GRCm39) missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43,690,432 (GRCm39) missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43,699,014 (GRCm39) missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43,690,393 (GRCm39) critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43,673,648 (GRCm39) splice site probably null
R7434:Jakmip2 UTSW 18 43,690,444 (GRCm39) missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43,710,390 (GRCm39) missense probably damaging 1.00
R7586:Jakmip2 UTSW 18 43,673,676 (GRCm39) missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43,704,973 (GRCm39) missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43,696,398 (GRCm39) missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43,715,323 (GRCm39) missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43,715,352 (GRCm39) missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43,685,242 (GRCm39) missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43,715,194 (GRCm39) missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43,704,961 (GRCm39) missense probably benign
R9691:Jakmip2 UTSW 18 43,673,685 (GRCm39) missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43,704,927 (GRCm39) missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43,699,035 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCGGGCATTTGAAATGAAACC -3'
(R):5'- GTACTCGGCCATTTTAGTTCATG -3'

Sequencing Primer
(F):5'- ACCAGAAGTATGAAGTGCTTTGTG -3'
(R):5'- AAAAGTGTGTCATCTCCTGGG -3'
Posted On 2019-10-17