Incidental Mutation 'R7516:Sh3bp4'
ID 582430
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission 045589-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 88998137-89082790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 89073368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 739 (L739M)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect probably damaging
Transcript: ENSMUST00000066279
AA Change: L739M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: L739M

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,868,125 (GRCm39) I407F probably damaging Het
Agbl1 A G 7: 76,075,669 (GRCm39) Y437C probably damaging Het
Alkbh5 T C 11: 60,429,979 (GRCm39) V244A probably damaging Het
Arap1 T C 7: 101,058,538 (GRCm39) F1390L probably benign Het
Asph T C 4: 9,630,940 (GRCm39) D136G possibly damaging Het
Atp8a2 A T 14: 60,094,516 (GRCm39) Y841N probably damaging Het
Cald1 A T 6: 34,686,492 (GRCm39) probably benign Het
Capn11 A G 17: 45,949,766 (GRCm39) I400T possibly damaging Het
Cdh18 T A 15: 23,259,684 (GRCm39) probably null Het
Ces2h T A 8: 105,743,458 (GRCm39) L204Q probably damaging Het
Chrna3 G A 9: 54,922,653 (GRCm39) A385V probably benign Het
Clca4a A T 3: 144,672,009 (GRCm39) L311Q probably damaging Het
Clip1 A G 5: 123,721,448 (GRCm39) V1149A probably benign Het
Clip3 T A 7: 29,998,268 (GRCm39) V238D possibly damaging Het
Col12a1 A G 9: 79,520,192 (GRCm39) probably null Het
Coro2a A G 4: 46,562,992 (GRCm39) V54A probably benign Het
Crem T C 18: 3,299,141 (GRCm39) probably null Het
Dennd5b T C 6: 148,969,878 (GRCm39) I192V probably benign Het
Dst A G 1: 34,209,560 (GRCm39) N1209S probably benign Het
Ero1a T A 14: 45,525,480 (GRCm39) M385L probably benign Het
Fam13a A T 6: 58,932,248 (GRCm39) V375D probably damaging Het
Fgfbp3 T A 19: 36,896,324 (GRCm39) Y98F possibly damaging Het
Frem3 T C 8: 81,338,712 (GRCm39) V335A probably damaging Het
Gm19410 T A 8: 36,263,433 (GRCm39) D951E probably benign Het
Gpatch1 T C 7: 35,007,625 (GRCm39) D145G probably benign Het
H60c G T 10: 3,209,746 (GRCm39) C180* probably null Het
Hmcn1 T C 1: 150,498,718 (GRCm39) T4054A probably benign Het
Hrg A G 16: 22,780,048 (GRCm39) Y442C unknown Het
Hspg2 C T 4: 137,269,931 (GRCm39) R2327C possibly damaging Het
Klhl31 G T 9: 77,558,429 (GRCm39) A382S probably damaging Het
Knl1 T C 2: 118,901,179 (GRCm39) V960A probably damaging Het
Lztr1 C T 16: 17,327,525 (GRCm39) A76V possibly damaging Het
Me3 G T 7: 89,497,183 (GRCm39) E395* probably null Het
Morc2b G A 17: 33,356,435 (GRCm39) H446Y probably benign Het
Mroh7 A T 4: 106,548,316 (GRCm39) M1054K probably benign Het
Ms4a6b T C 19: 11,506,907 (GRCm39) V232A probably benign Het
Nmt2 C A 2: 3,313,767 (GRCm39) D224E probably damaging Het
Nox4 C A 7: 86,970,905 (GRCm39) R261S probably benign Het
Obscn T A 11: 59,015,416 (GRCm39) K1019* probably null Het
Or4a15 T A 2: 89,193,719 (GRCm39) N18I probably benign Het
Or4g7 T A 2: 111,309,282 (GRCm39) V51D probably benign Het
Or5p67 G A 7: 107,922,223 (GRCm39) S220F probably damaging Het
Or8k24 C T 2: 86,216,328 (GRCm39) V145I probably benign Het
Pcdha11 A T 18: 37,144,671 (GRCm39) N254I probably damaging Het
Pck2 T A 14: 55,779,913 (GRCm39) I54N probably benign Het
Pkd1l3 T A 8: 110,361,861 (GRCm39) W978R probably damaging Het
Plxna4 T C 6: 32,214,703 (GRCm39) T593A probably benign Het
Podn G A 4: 107,879,321 (GRCm39) R266W probably damaging Het
Ptpn22 A G 3: 103,792,854 (GRCm39) D335G probably benign Het
Pxn A G 5: 115,644,922 (GRCm39) D3G unknown Het
Rapgefl1 T G 11: 98,736,960 (GRCm39) V320G probably benign Het
Rel A G 11: 23,692,785 (GRCm39) I416T probably benign Het
Sema5b A G 16: 35,471,540 (GRCm39) N378D probably benign Het
Skint2 A T 4: 112,483,168 (GRCm39) D191V probably damaging Het
Slc3a1 T C 17: 85,371,190 (GRCm39) Y581H probably damaging Het
Smcr8 G T 11: 60,670,814 (GRCm39) C654F probably benign Het
Spta1 A C 1: 174,025,349 (GRCm39) Q738P probably damaging Het
Sptlc3 C A 2: 139,431,438 (GRCm39) A320D probably benign Het
Thnsl2 T A 6: 71,108,990 (GRCm39) K274* probably null Het
Tmed2 T A 5: 124,685,055 (GRCm39) I68K possibly damaging Het
Tmtc4 G A 14: 123,180,735 (GRCm39) A326V possibly damaging Het
Tnks2 T A 19: 36,849,064 (GRCm39) S179T possibly damaging Het
Trim34b G T 7: 103,978,918 (GRCm39) C55F probably damaging Het
Trpm4 T A 7: 44,954,444 (GRCm39) E1129V probably damaging Het
Tvp23b T C 11: 62,782,867 (GRCm39) S188P possibly damaging Het
Usp1 A G 4: 98,822,356 (GRCm39) T557A probably damaging Het
Vmn2r66 C T 7: 84,661,176 (GRCm39) C18Y possibly damaging Het
Vmn2r85 T A 10: 130,254,852 (GRCm39) T611S probably damaging Het
Vps13c T C 9: 67,862,289 (GRCm39) S2969P possibly damaging Het
Wdr74 T A 19: 8,713,554 (GRCm39) C62* probably null Het
Wfikkn1 A T 17: 26,097,020 (GRCm39) C435S probably damaging Het
Zbtb45 A T 7: 12,740,269 (GRCm39) F449I probably damaging Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89,071,682 (GRCm39) missense probably benign
IGL01344:Sh3bp4 APN 1 89,080,958 (GRCm39) missense probably benign
IGL02025:Sh3bp4 APN 1 89,073,008 (GRCm39) missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89,071,412 (GRCm39) missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89,072,870 (GRCm39) missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89,080,885 (GRCm39) missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89,071,266 (GRCm39) splice site probably benign
IGL03327:Sh3bp4 APN 1 89,071,885 (GRCm39) nonsense probably null
I0000:Sh3bp4 UTSW 1 89,065,518 (GRCm39) missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89,073,156 (GRCm39) missense probably benign
R0128:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89,071,494 (GRCm39) missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89,073,210 (GRCm39) missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89,073,314 (GRCm39) missense possibly damaging 0.62
R3407:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3408:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89,073,050 (GRCm39) missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89,073,591 (GRCm39) missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89,071,995 (GRCm39) missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89,073,317 (GRCm39) missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89,071,962 (GRCm39) missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89,065,456 (GRCm39) missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89,071,997 (GRCm39) missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89,073,072 (GRCm39) missense probably benign
R5908:Sh3bp4 UTSW 1 89,073,605 (GRCm39) missense probably damaging 0.99
R6296:Sh3bp4 UTSW 1 89,073,211 (GRCm39) missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89,072,643 (GRCm39) missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89,080,888 (GRCm39) missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89,073,489 (GRCm39) missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89,080,824 (GRCm39) splice site probably null
R7320:Sh3bp4 UTSW 1 89,073,216 (GRCm39) missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89,072,170 (GRCm39) missense possibly damaging 0.79
R8402:Sh3bp4 UTSW 1 89,073,037 (GRCm39) missense probably benign 0.00
R8899:Sh3bp4 UTSW 1 89,073,297 (GRCm39) missense probably benign 0.45
R8915:Sh3bp4 UTSW 1 89,080,064 (GRCm39) missense probably damaging 0.99
R8953:Sh3bp4 UTSW 1 89,072,159 (GRCm39) missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89,072,647 (GRCm39) nonsense probably null
R9718:Sh3bp4 UTSW 1 89,073,472 (GRCm39) missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89,072,744 (GRCm39) missense probably benign
Z1176:Sh3bp4 UTSW 1 89,073,450 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCACTACCTGCTGGAGTACAAG -3'
(R):5'- CTTGAGCTTTTCCAGAACGG -3'

Sequencing Primer
(F):5'- AAAGGTGACGTCGTGGCTC -3'
(R):5'- CGGAAGCCACCCGTTCC -3'
Posted On 2019-10-17