Incidental Mutation 'R7516:Olfr1058'
ID582434
Institutional Source Beutler Lab
Gene Symbol Olfr1058
Ensembl Gene ENSMUSG00000075186
Gene Nameolfactory receptor 1058
SynonymsGA_x6K02T2Q125-47855818-47854868, MOR190-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R7516 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86384760-86388561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86385984 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 145 (V145I)
Ref Sequence ENSEMBL: ENSMUSP00000151037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102631] [ENSMUST00000213998]
Predicted Effect probably benign
Transcript: ENSMUST00000102631
AA Change: V145I

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099691
Gene: ENSMUSG00000075186
AA Change: V145I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-49 PFAM
Pfam:7tm_1 41 290 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213998
AA Change: V145I

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,630,676 I407F probably damaging Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Alkbh5 T C 11: 60,539,153 V244A probably damaging Het
Arap1 T C 7: 101,409,331 F1390L probably benign Het
Asph T C 4: 9,630,940 D136G possibly damaging Het
Atp8a2 A T 14: 59,857,067 Y841N probably damaging Het
Cald1 A T 6: 34,709,557 probably benign Het
Capn11 A G 17: 45,638,840 I400T possibly damaging Het
Cdh18 T A 15: 23,259,598 probably null Het
Ces2h T A 8: 105,016,826 L204Q probably damaging Het
Chrna3 G A 9: 55,015,369 A385V probably benign Het
Clca4a A T 3: 144,966,248 L311Q probably damaging Het
Clip1 A G 5: 123,583,385 V1149A probably benign Het
Clip3 T A 7: 30,298,843 V238D possibly damaging Het
Col12a1 A G 9: 79,612,910 probably null Het
Coro2a A G 4: 46,562,992 V54A probably benign Het
Crem T C 18: 3,299,141 probably null Het
Dennd5b T C 6: 149,068,380 I192V probably benign Het
Dst A G 1: 34,170,479 N1209S probably benign Het
Ero1l T A 14: 45,288,023 M385L probably benign Het
Fam13a A T 6: 58,955,263 V375D probably damaging Het
Fgfbp3 T A 19: 36,918,924 Y98F possibly damaging Het
Frem3 T C 8: 80,612,083 V335A probably damaging Het
Gm19410 T A 8: 35,796,279 D951E probably benign Het
Gpatch1 T C 7: 35,308,200 D145G probably benign Het
H60c G T 10: 3,259,746 C180* probably null Het
Hmcn1 T C 1: 150,622,967 T4054A probably benign Het
Hrg A G 16: 22,961,298 Y442C unknown Het
Hspg2 C T 4: 137,542,620 R2327C possibly damaging Het
Klhl31 G T 9: 77,651,147 A382S probably damaging Het
Knl1 T C 2: 119,070,698 V960A probably damaging Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Me3 G T 7: 89,847,975 E395* probably null Het
Morc2b G A 17: 33,137,461 H446Y probably benign Het
Mroh7 A T 4: 106,691,119 M1054K probably benign Het
Ms4a6b T C 19: 11,529,543 V232A probably benign Het
Nmt2 C A 2: 3,312,730 D224E probably damaging Het
Nox4 C A 7: 87,321,697 R261S probably benign Het
Obscn T A 11: 59,124,590 K1019* probably null Het
Olfr1234 T A 2: 89,363,375 N18I probably benign Het
Olfr1288 T A 2: 111,478,937 V51D probably benign Het
Olfr492 G A 7: 108,323,016 S220F probably damaging Het
Pcdha11 A T 18: 37,011,618 N254I probably damaging Het
Pck2 T A 14: 55,542,456 I54N probably benign Het
Pkd1l3 T A 8: 109,635,229 W978R probably damaging Het
Plxna4 T C 6: 32,237,768 T593A probably benign Het
Podn G A 4: 108,022,124 R266W probably damaging Het
Ptpn22 A G 3: 103,885,538 D335G probably benign Het
Pxn A G 5: 115,506,863 D3G unknown Het
Rapgefl1 T G 11: 98,846,134 V320G probably benign Het
Rel A G 11: 23,742,785 I416T probably benign Het
Sema5b A G 16: 35,651,170 N378D probably benign Het
Sh3bp4 C A 1: 89,145,646 L739M probably damaging Het
Skint2 A T 4: 112,625,971 D191V probably damaging Het
Slc3a1 T C 17: 85,063,762 Y581H probably damaging Het
Smcr8 G T 11: 60,779,988 C654F probably benign Het
Spta1 A C 1: 174,197,783 Q738P probably damaging Het
Sptlc3 C A 2: 139,589,518 A320D probably benign Het
Thnsl2 T A 6: 71,132,006 K274* probably null Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmtc4 G A 14: 122,943,323 A326V possibly damaging Het
Tnks2 T A 19: 36,871,664 S179T possibly damaging Het
Trim34b G T 7: 104,329,711 C55F probably damaging Het
Trpm4 T A 7: 45,305,020 E1129V probably damaging Het
Tvp23b T C 11: 62,892,041 S188P possibly damaging Het
Usp1 A G 4: 98,934,119 T557A probably damaging Het
Vmn2r66 C T 7: 85,011,968 C18Y possibly damaging Het
Vmn2r85 T A 10: 130,418,983 T611S probably damaging Het
Vps13c T C 9: 67,955,007 S2969P possibly damaging Het
Wdr74 T A 19: 8,736,190 C62* probably null Het
Wfikkn1 A T 17: 25,878,046 C435S probably damaging Het
Zbtb45 A T 7: 13,006,342 F449I probably damaging Het
Other mutations in Olfr1058
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr1058 APN 2 86386021 nonsense probably null
R0413:Olfr1058 UTSW 2 86385714 missense probably benign 0.02
R1315:Olfr1058 UTSW 2 86386174 missense possibly damaging 0.86
R1609:Olfr1058 UTSW 2 86385494 missense probably benign 0.07
R1951:Olfr1058 UTSW 2 86385511 missense probably benign 0.03
R2184:Olfr1058 UTSW 2 86386145 missense probably benign 0.05
R2351:Olfr1058 UTSW 2 86386127 missense probably damaging 0.99
R4067:Olfr1058 UTSW 2 86386087 nonsense probably null
R4706:Olfr1058 UTSW 2 86386388 missense probably benign 0.29
R5164:Olfr1058 UTSW 2 86385471 missense probably benign
R5224:Olfr1058 UTSW 2 86385849 missense possibly damaging 0.91
R5254:Olfr1058 UTSW 2 86386140 missense possibly damaging 0.65
R5424:Olfr1058 UTSW 2 86385840 nonsense probably null
R5907:Olfr1058 UTSW 2 86385874 missense probably damaging 0.97
R5980:Olfr1058 UTSW 2 86385797 nonsense probably null
R6348:Olfr1058 UTSW 2 86386169 missense probably benign
R6874:Olfr1058 UTSW 2 86385528 missense possibly damaging 0.95
R6897:Olfr1058 UTSW 2 86385680 missense possibly damaging 0.91
R7060:Olfr1058 UTSW 2 86386225 missense possibly damaging 0.95
R7530:Olfr1058 UTSW 2 86386171 missense probably damaging 1.00
Z1088:Olfr1058 UTSW 2 86385756 missense probably benign 0.43
Z1088:Olfr1058 UTSW 2 86386179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGAAAGCCTTGCGCCTG -3'
(R):5'- ATACAACAGCTGTGGGACC -3'

Sequencing Primer
(F):5'- GCAGAGTGCATCCTGATAATAGC -3'
(R):5'- CAGCTGTGGGACCAAAAATGTTAC -3'
Posted On2019-10-17