Incidental Mutation 'R7516:Coro2a'
ID582442
Institutional Source Beutler Lab
Gene Symbol Coro2a
Ensembl Gene ENSMUSG00000028337
Gene Namecoronin, actin binding protein 2A
Synonymscoronin 4, IR10, 9030208C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7516 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46536937-46602202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46562992 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 54 (V54A)
Ref Sequence ENSEMBL: ENSMUSP00000103386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030021] [ENSMUST00000107756] [ENSMUST00000107757]
Predicted Effect probably benign
Transcript: ENSMUST00000030021
AA Change: V35A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030021
Gene: ENSMUSG00000028337
AA Change: V35A

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107756
AA Change: V35A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103385
Gene: ENSMUSG00000028337
AA Change: V35A

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107757
AA Change: V54A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103386
Gene: ENSMUSG00000028337
AA Change: V54A

DomainStartEndE-ValueType
DUF1899 24 88 3.93e-33 SMART
WD40 87 130 2.04e-5 SMART
WD40 140 180 1.58e-2 SMART
WD40 188 227 2.55e-6 SMART
DUF1900 280 416 9.15e-84 SMART
coiled coil region 507 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 5 WD repeats, and has a structural similarity with actin-binding proteins: the D. discoideum coronin and the human p57 protein, suggesting that this protein may also be an actin-binding protein that regulates cell motility. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,630,676 I407F probably damaging Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Alkbh5 T C 11: 60,539,153 V244A probably damaging Het
Arap1 T C 7: 101,409,331 F1390L probably benign Het
Asph T C 4: 9,630,940 D136G possibly damaging Het
Atp8a2 A T 14: 59,857,067 Y841N probably damaging Het
Cald1 A T 6: 34,709,557 probably benign Het
Capn11 A G 17: 45,638,840 I400T possibly damaging Het
Cdh18 T A 15: 23,259,598 probably null Het
Ces2h T A 8: 105,016,826 L204Q probably damaging Het
Chrna3 G A 9: 55,015,369 A385V probably benign Het
Clca4a A T 3: 144,966,248 L311Q probably damaging Het
Clip1 A G 5: 123,583,385 V1149A probably benign Het
Clip3 T A 7: 30,298,843 V238D possibly damaging Het
Col12a1 A G 9: 79,612,910 probably null Het
Crem T C 18: 3,299,141 probably null Het
Dennd5b T C 6: 149,068,380 I192V probably benign Het
Dst A G 1: 34,170,479 N1209S probably benign Het
Ero1l T A 14: 45,288,023 M385L probably benign Het
Fam13a A T 6: 58,955,263 V375D probably damaging Het
Fgfbp3 T A 19: 36,918,924 Y98F possibly damaging Het
Frem3 T C 8: 80,612,083 V335A probably damaging Het
Gm19410 T A 8: 35,796,279 D951E probably benign Het
Gpatch1 T C 7: 35,308,200 D145G probably benign Het
H60c G T 10: 3,259,746 C180* probably null Het
Hmcn1 T C 1: 150,622,967 T4054A probably benign Het
Hrg A G 16: 22,961,298 Y442C unknown Het
Hspg2 C T 4: 137,542,620 R2327C possibly damaging Het
Klhl31 G T 9: 77,651,147 A382S probably damaging Het
Knl1 T C 2: 119,070,698 V960A probably damaging Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Me3 G T 7: 89,847,975 E395* probably null Het
Morc2b G A 17: 33,137,461 H446Y probably benign Het
Mroh7 A T 4: 106,691,119 M1054K probably benign Het
Ms4a6b T C 19: 11,529,543 V232A probably benign Het
Nmt2 C A 2: 3,312,730 D224E probably damaging Het
Nox4 C A 7: 87,321,697 R261S probably benign Het
Obscn T A 11: 59,124,590 K1019* probably null Het
Olfr1058 C T 2: 86,385,984 V145I probably benign Het
Olfr1234 T A 2: 89,363,375 N18I probably benign Het
Olfr1288 T A 2: 111,478,937 V51D probably benign Het
Olfr492 G A 7: 108,323,016 S220F probably damaging Het
Pcdha11 A T 18: 37,011,618 N254I probably damaging Het
Pck2 T A 14: 55,542,456 I54N probably benign Het
Pkd1l3 T A 8: 109,635,229 W978R probably damaging Het
Plxna4 T C 6: 32,237,768 T593A probably benign Het
Podn G A 4: 108,022,124 R266W probably damaging Het
Ptpn22 A G 3: 103,885,538 D335G probably benign Het
Pxn A G 5: 115,506,863 D3G unknown Het
Rapgefl1 T G 11: 98,846,134 V320G probably benign Het
Rel A G 11: 23,742,785 I416T probably benign Het
Sema5b A G 16: 35,651,170 N378D probably benign Het
Sh3bp4 C A 1: 89,145,646 L739M probably damaging Het
Skint2 A T 4: 112,625,971 D191V probably damaging Het
Slc3a1 T C 17: 85,063,762 Y581H probably damaging Het
Smcr8 G T 11: 60,779,988 C654F probably benign Het
Spta1 A C 1: 174,197,783 Q738P probably damaging Het
Sptlc3 C A 2: 139,589,518 A320D probably benign Het
Thnsl2 T A 6: 71,132,006 K274* probably null Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmtc4 G A 14: 122,943,323 A326V possibly damaging Het
Tnks2 T A 19: 36,871,664 S179T possibly damaging Het
Trim34b G T 7: 104,329,711 C55F probably damaging Het
Trpm4 T A 7: 45,305,020 E1129V probably damaging Het
Tvp23b T C 11: 62,892,041 S188P possibly damaging Het
Usp1 A G 4: 98,934,119 T557A probably damaging Het
Vmn2r66 C T 7: 85,011,968 C18Y possibly damaging Het
Vmn2r85 T A 10: 130,418,983 T611S probably damaging Het
Vps13c T C 9: 67,955,007 S2969P possibly damaging Het
Wdr74 T A 19: 8,736,190 C62* probably null Het
Wfikkn1 A T 17: 25,878,046 C435S probably damaging Het
Zbtb45 A T 7: 13,006,342 F449I probably damaging Het
Other mutations in Coro2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Coro2a APN 4 46540455 missense probably benign 0.06
IGL03093:Coro2a APN 4 46544158 missense possibly damaging 0.93
R1562:Coro2a UTSW 4 46548917 missense probably benign 0.02
R1862:Coro2a UTSW 4 46548797 missense possibly damaging 0.93
R1931:Coro2a UTSW 4 46539138 makesense probably null
R4385:Coro2a UTSW 4 46541961 missense possibly damaging 0.93
R5171:Coro2a UTSW 4 46542372 intron probably benign
R5243:Coro2a UTSW 4 46545620 missense probably damaging 1.00
R5393:Coro2a UTSW 4 46542255 missense probably damaging 1.00
R5785:Coro2a UTSW 4 46564691 missense probably benign 0.03
R6014:Coro2a UTSW 4 46542261 missense probably damaging 1.00
R6184:Coro2a UTSW 4 46540504 missense probably benign
R6264:Coro2a UTSW 4 46562912 missense probably damaging 1.00
R6601:Coro2a UTSW 4 46543421 nonsense probably null
R6732:Coro2a UTSW 4 46551374 missense probably damaging 0.99
R6760:Coro2a UTSW 4 46540572 missense probably benign
R7499:Coro2a UTSW 4 46539188 missense probably benign 0.01
R7567:Coro2a UTSW 4 46546674 missense probably damaging 0.99
R7816:Coro2a UTSW 4 46546809 missense probably benign 0.01
R8008:Coro2a UTSW 4 46551349 missense probably damaging 1.00
RF012:Coro2a UTSW 4 46542336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTGAGAGCTCAACTC -3'
(R):5'- GTAGTCTCACTGTGTTCCATGG -3'

Sequencing Primer
(F):5'- GAGCTCAACTCTTAGGATATCGAC -3'
(R):5'- CTCACTGTGTTCCATGGTAAAGCAG -3'
Posted On2019-10-17