Incidental Mutation 'R7516:Usp1'
ID582443
Institutional Source Beutler Lab
Gene Symbol Usp1
Ensembl Gene ENSMUSG00000028560
Gene Nameubiquitin specific peptidase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R7516 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location98923810-98935543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98934119 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 557 (T557A)
Ref Sequence ENSEMBL: ENSMUSP00000030289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000030289] [ENSMUST00000075836] [ENSMUST00000091358] [ENSMUST00000125104] [ENSMUST00000127417] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030289
AA Change: T557A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030289
Gene: ENSMUSG00000028560
AA Change: T557A

DomainStartEndE-ValueType
Pfam:UCH 80 616 9.2e-35 PFAM
Pfam:UCH_1 415 618 1.3e-11 PFAM
Pfam:UCH 723 781 3.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091358
AA Change: T557A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088917
Gene: ENSMUSG00000028560
AA Change: T557A

DomainStartEndE-ValueType
Pfam:UCH 80 622 5e-39 PFAM
Pfam:UCH_1 346 613 2.8e-11 PFAM
low complexity region 765 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124466
Predicted Effect probably benign
Transcript: ENSMUST00000125104
SMART Domains Protein: ENSMUSP00000135496
Gene: ENSMUSG00000028560

DomainStartEndE-ValueType
Pfam:UCH 37 150 4.1e-14 PFAM
Pfam:UCH_1 38 80 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205650
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ubiquitin-specific peptidase family. The encoded protein acts as a catalytic subunit in a heterodimeric deubiquitinating enzyme complex that deubiquitinates Fanconi anemia, complementation group D2, and plays a role in homologous recombination-mediated DNA repair. Disruption of this gene is associated with a Fanconi anemia-like phenotype and genomic instability. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 3, 12, and 15. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice have a high rate of postnatal lethality related to cyanosis. Male survivors are infertile while female survivors have reduced fertility. Both sexes have reduced number of gametes, are sensitive to ionizing radiation, and have decreased numbers of bone marrow cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,630,676 I407F probably damaging Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Alkbh5 T C 11: 60,539,153 V244A probably damaging Het
Arap1 T C 7: 101,409,331 F1390L probably benign Het
Asph T C 4: 9,630,940 D136G possibly damaging Het
Atp8a2 A T 14: 59,857,067 Y841N probably damaging Het
Cald1 A T 6: 34,709,557 probably benign Het
Capn11 A G 17: 45,638,840 I400T possibly damaging Het
Cdh18 T A 15: 23,259,598 probably null Het
Ces2h T A 8: 105,016,826 L204Q probably damaging Het
Chrna3 G A 9: 55,015,369 A385V probably benign Het
Clca4a A T 3: 144,966,248 L311Q probably damaging Het
Clip1 A G 5: 123,583,385 V1149A probably benign Het
Clip3 T A 7: 30,298,843 V238D possibly damaging Het
Col12a1 A G 9: 79,612,910 probably null Het
Coro2a A G 4: 46,562,992 V54A probably benign Het
Crem T C 18: 3,299,141 probably null Het
Dennd5b T C 6: 149,068,380 I192V probably benign Het
Dst A G 1: 34,170,479 N1209S probably benign Het
Ero1l T A 14: 45,288,023 M385L probably benign Het
Fam13a A T 6: 58,955,263 V375D probably damaging Het
Fgfbp3 T A 19: 36,918,924 Y98F possibly damaging Het
Frem3 T C 8: 80,612,083 V335A probably damaging Het
Gm19410 T A 8: 35,796,279 D951E probably benign Het
Gpatch1 T C 7: 35,308,200 D145G probably benign Het
H60c G T 10: 3,259,746 C180* probably null Het
Hmcn1 T C 1: 150,622,967 T4054A probably benign Het
Hrg A G 16: 22,961,298 Y442C unknown Het
Hspg2 C T 4: 137,542,620 R2327C possibly damaging Het
Klhl31 G T 9: 77,651,147 A382S probably damaging Het
Knl1 T C 2: 119,070,698 V960A probably damaging Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Me3 G T 7: 89,847,975 E395* probably null Het
Morc2b G A 17: 33,137,461 H446Y probably benign Het
Mroh7 A T 4: 106,691,119 M1054K probably benign Het
Ms4a6b T C 19: 11,529,543 V232A probably benign Het
Nmt2 C A 2: 3,312,730 D224E probably damaging Het
Nox4 C A 7: 87,321,697 R261S probably benign Het
Obscn T A 11: 59,124,590 K1019* probably null Het
Olfr1058 C T 2: 86,385,984 V145I probably benign Het
Olfr1234 T A 2: 89,363,375 N18I probably benign Het
Olfr1288 T A 2: 111,478,937 V51D probably benign Het
Olfr492 G A 7: 108,323,016 S220F probably damaging Het
Pcdha11 A T 18: 37,011,618 N254I probably damaging Het
Pck2 T A 14: 55,542,456 I54N probably benign Het
Pkd1l3 T A 8: 109,635,229 W978R probably damaging Het
Plxna4 T C 6: 32,237,768 T593A probably benign Het
Podn G A 4: 108,022,124 R266W probably damaging Het
Ptpn22 A G 3: 103,885,538 D335G probably benign Het
Pxn A G 5: 115,506,863 D3G unknown Het
Rapgefl1 T G 11: 98,846,134 V320G probably benign Het
Rel A G 11: 23,742,785 I416T probably benign Het
Sema5b A G 16: 35,651,170 N378D probably benign Het
Sh3bp4 C A 1: 89,145,646 L739M probably damaging Het
Skint2 A T 4: 112,625,971 D191V probably damaging Het
Slc3a1 T C 17: 85,063,762 Y581H probably damaging Het
Smcr8 G T 11: 60,779,988 C654F probably benign Het
Spta1 A C 1: 174,197,783 Q738P probably damaging Het
Sptlc3 C A 2: 139,589,518 A320D probably benign Het
Thnsl2 T A 6: 71,132,006 K274* probably null Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmtc4 G A 14: 122,943,323 A326V possibly damaging Het
Tnks2 T A 19: 36,871,664 S179T possibly damaging Het
Trim34b G T 7: 104,329,711 C55F probably damaging Het
Trpm4 T A 7: 45,305,020 E1129V probably damaging Het
Tvp23b T C 11: 62,892,041 S188P possibly damaging Het
Vmn2r66 C T 7: 85,011,968 C18Y possibly damaging Het
Vmn2r85 T A 10: 130,418,983 T611S probably damaging Het
Vps13c T C 9: 67,955,007 S2969P possibly damaging Het
Wdr74 T A 19: 8,736,190 C62* probably null Het
Wfikkn1 A T 17: 25,878,046 C435S probably damaging Het
Zbtb45 A T 7: 13,006,342 F449I probably damaging Het
Other mutations in Usp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Usp1 APN 4 98934581 unclassified probably null
IGL02692:Usp1 APN 4 98928960 missense probably benign 0.00
R1782:Usp1 UTSW 4 98934198 missense probably damaging 1.00
R1991:Usp1 UTSW 4 98934294 missense probably benign 0.00
R1992:Usp1 UTSW 4 98934294 missense probably benign 0.00
R2273:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R2274:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R2275:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R3750:Usp1 UTSW 4 98934120 unclassified probably null
R3886:Usp1 UTSW 4 98929736 missense probably damaging 1.00
R4014:Usp1 UTSW 4 98934702 missense probably damaging 1.00
R5141:Usp1 UTSW 4 98934209 missense probably damaging 1.00
R5304:Usp1 UTSW 4 98934618 missense probably benign
R5388:Usp1 UTSW 4 98931057 missense probably benign
R5709:Usp1 UTSW 4 98931123 missense probably damaging 0.99
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6592:Usp1 UTSW 4 98926519 missense possibly damaging 0.86
R6956:Usp1 UTSW 4 98931006 missense probably damaging 0.96
R7117:Usp1 UTSW 4 98928890 missense possibly damaging 0.59
R7396:Usp1 UTSW 4 98926451 intron probably benign
R7590:Usp1 UTSW 4 98934252 missense possibly damaging 0.67
R7828:Usp1 UTSW 4 98932307 missense probably damaging 1.00
R8050:Usp1 UTSW 4 98928913 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGCATTTTCCTCAGAATTGAAGCC -3'
(R):5'- TCATCGTCGTAGTTCCCAGC -3'

Sequencing Primer
(F):5'- CTCAGAATTGAAGCCTTAGTTTGCC -3'
(R):5'- CAGTGGCTCTGGCTTACCTAG -3'
Posted On2019-10-17