Incidental Mutation 'R7516:Mroh7'
ID 582444
Institutional Source Beutler Lab
Gene Symbol Mroh7
Ensembl Gene ENSMUSG00000047502
Gene Name maestro heat-like repeat family member 7
Synonyms Heatr8, LOC381538, Gm1027
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7516 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 106680417-106730925 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106691119 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1054 (M1054K)
Ref Sequence ENSEMBL: ENSMUSP00000102382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106770]
AlphaFold A2AVR2
Predicted Effect probably benign
Transcript: ENSMUST00000106770
AA Change: M1054K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: M1054K

DomainStartEndE-ValueType
low complexity region 39 61 N/A INTRINSIC
low complexity region 318 332 N/A INTRINSIC
low complexity region 563 573 N/A INTRINSIC
SCOP:d1b3ua_ 634 1218 6e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,630,676 I407F probably damaging Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Alkbh5 T C 11: 60,539,153 V244A probably damaging Het
Arap1 T C 7: 101,409,331 F1390L probably benign Het
Asph T C 4: 9,630,940 D136G possibly damaging Het
Atp8a2 A T 14: 59,857,067 Y841N probably damaging Het
Cald1 A T 6: 34,709,557 probably benign Het
Capn11 A G 17: 45,638,840 I400T possibly damaging Het
Cdh18 T A 15: 23,259,598 probably null Het
Ces2h T A 8: 105,016,826 L204Q probably damaging Het
Chrna3 G A 9: 55,015,369 A385V probably benign Het
Clca4a A T 3: 144,966,248 L311Q probably damaging Het
Clip1 A G 5: 123,583,385 V1149A probably benign Het
Clip3 T A 7: 30,298,843 V238D possibly damaging Het
Col12a1 A G 9: 79,612,910 probably null Het
Coro2a A G 4: 46,562,992 V54A probably benign Het
Crem T C 18: 3,299,141 probably null Het
Dennd5b T C 6: 149,068,380 I192V probably benign Het
Dst A G 1: 34,170,479 N1209S probably benign Het
Ero1l T A 14: 45,288,023 M385L probably benign Het
Fam13a A T 6: 58,955,263 V375D probably damaging Het
Fgfbp3 T A 19: 36,918,924 Y98F possibly damaging Het
Frem3 T C 8: 80,612,083 V335A probably damaging Het
Gm19410 T A 8: 35,796,279 D951E probably benign Het
Gpatch1 T C 7: 35,308,200 D145G probably benign Het
H60c G T 10: 3,259,746 C180* probably null Het
Hmcn1 T C 1: 150,622,967 T4054A probably benign Het
Hrg A G 16: 22,961,298 Y442C unknown Het
Hspg2 C T 4: 137,542,620 R2327C possibly damaging Het
Klhl31 G T 9: 77,651,147 A382S probably damaging Het
Knl1 T C 2: 119,070,698 V960A probably damaging Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Me3 G T 7: 89,847,975 E395* probably null Het
Morc2b G A 17: 33,137,461 H446Y probably benign Het
Ms4a6b T C 19: 11,529,543 V232A probably benign Het
Nmt2 C A 2: 3,312,730 D224E probably damaging Het
Nox4 C A 7: 87,321,697 R261S probably benign Het
Obscn T A 11: 59,124,590 K1019* probably null Het
Olfr1058 C T 2: 86,385,984 V145I probably benign Het
Olfr1234 T A 2: 89,363,375 N18I probably benign Het
Olfr1288 T A 2: 111,478,937 V51D probably benign Het
Olfr492 G A 7: 108,323,016 S220F probably damaging Het
Pcdha11 A T 18: 37,011,618 N254I probably damaging Het
Pck2 T A 14: 55,542,456 I54N probably benign Het
Pkd1l3 T A 8: 109,635,229 W978R probably damaging Het
Plxna4 T C 6: 32,237,768 T593A probably benign Het
Podn G A 4: 108,022,124 R266W probably damaging Het
Ptpn22 A G 3: 103,885,538 D335G probably benign Het
Pxn A G 5: 115,506,863 D3G unknown Het
Rapgefl1 T G 11: 98,846,134 V320G probably benign Het
Rel A G 11: 23,742,785 I416T probably benign Het
Sema5b A G 16: 35,651,170 N378D probably benign Het
Sh3bp4 C A 1: 89,145,646 L739M probably damaging Het
Skint2 A T 4: 112,625,971 D191V probably damaging Het
Slc3a1 T C 17: 85,063,762 Y581H probably damaging Het
Smcr8 G T 11: 60,779,988 C654F probably benign Het
Spta1 A C 1: 174,197,783 Q738P probably damaging Het
Sptlc3 C A 2: 139,589,518 A320D probably benign Het
Thnsl2 T A 6: 71,132,006 K274* probably null Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmtc4 G A 14: 122,943,323 A326V possibly damaging Het
Tnks2 T A 19: 36,871,664 S179T possibly damaging Het
Trim34b G T 7: 104,329,711 C55F probably damaging Het
Trpm4 T A 7: 45,305,020 E1129V probably damaging Het
Tvp23b T C 11: 62,892,041 S188P possibly damaging Het
Usp1 A G 4: 98,934,119 T557A probably damaging Het
Vmn2r66 C T 7: 85,011,968 C18Y possibly damaging Het
Vmn2r85 T A 10: 130,418,983 T611S probably damaging Het
Vps13c T C 9: 67,955,007 S2969P possibly damaging Het
Wdr74 T A 19: 8,736,190 C62* probably null Het
Wfikkn1 A T 17: 25,878,046 C435S probably damaging Het
Zbtb45 A T 7: 13,006,342 F449I probably damaging Het
Other mutations in Mroh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Mroh7 APN 4 106703161 missense probably benign 0.00
IGL01729:Mroh7 APN 4 106704205 missense possibly damaging 0.66
IGL01834:Mroh7 APN 4 106680874 missense probably benign 0.00
IGL02003:Mroh7 APN 4 106702529 missense probably damaging 0.96
IGL02135:Mroh7 APN 4 106702510 missense probably damaging 1.00
IGL02335:Mroh7 APN 4 106707782 missense probably damaging 1.00
IGL02532:Mroh7 APN 4 106720591 missense probably benign 0.04
IGL02896:Mroh7 APN 4 106699816 missense possibly damaging 0.94
IGL03066:Mroh7 APN 4 106692398 missense possibly damaging 0.85
IGL03298:Mroh7 APN 4 106714091 nonsense probably null
holy UTSW 4 106709955 splice site probably null
moley UTSW 4 106694312 splice site probably null
P0016:Mroh7 UTSW 4 106707857 critical splice acceptor site probably null
R0019:Mroh7 UTSW 4 106721426 missense probably benign 0.07
R0094:Mroh7 UTSW 4 106703184 missense probably damaging 0.98
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0515:Mroh7 UTSW 4 106691664 missense probably benign 0.01
R0828:Mroh7 UTSW 4 106699876 missense probably damaging 0.99
R0831:Mroh7 UTSW 4 106680793 missense possibly damaging 0.92
R1107:Mroh7 UTSW 4 106707594 splice site probably null
R1301:Mroh7 UTSW 4 106720495 missense probably damaging 0.99
R1456:Mroh7 UTSW 4 106695141 splice site probably benign
R1491:Mroh7 UTSW 4 106703058 missense probably benign 0.11
R1540:Mroh7 UTSW 4 106703076 missense probably benign 0.11
R1560:Mroh7 UTSW 4 106711254 missense possibly damaging 0.78
R1645:Mroh7 UTSW 4 106720668 missense probably benign 0.19
R1804:Mroh7 UTSW 4 106694392 missense possibly damaging 0.76
R2162:Mroh7 UTSW 4 106700181 missense probably damaging 0.96
R2265:Mroh7 UTSW 4 106720927 missense probably benign 0.01
R2866:Mroh7 UTSW 4 106691090 missense probably damaging 1.00
R3716:Mroh7 UTSW 4 106704210 missense probably benign 0.25
R3718:Mroh7 UTSW 4 106704210 missense probably benign 0.25
R4530:Mroh7 UTSW 4 106720437 missense possibly damaging 0.71
R4661:Mroh7 UTSW 4 106691513 critical splice donor site probably null
R4706:Mroh7 UTSW 4 106691624 missense possibly damaging 0.86
R4910:Mroh7 UTSW 4 106709955 splice site probably null
R4965:Mroh7 UTSW 4 106690987 missense possibly damaging 0.77
R4969:Mroh7 UTSW 4 106680873 missense probably benign
R4971:Mroh7 UTSW 4 106691552 missense probably benign 0.04
R5083:Mroh7 UTSW 4 106690318 missense probably benign 0.03
R5207:Mroh7 UTSW 4 106721386 missense probably damaging 0.97
R5364:Mroh7 UTSW 4 106691643 missense probably benign 0.10
R5392:Mroh7 UTSW 4 106711251 critical splice donor site probably null
R5630:Mroh7 UTSW 4 106720567 missense possibly damaging 0.71
R5691:Mroh7 UTSW 4 106702618 missense probably damaging 0.96
R5703:Mroh7 UTSW 4 106708560 missense possibly damaging 0.77
R5707:Mroh7 UTSW 4 106681885 missense possibly damaging 0.73
R5919:Mroh7 UTSW 4 106694312 splice site probably null
R5979:Mroh7 UTSW 4 106720926 missense probably benign 0.00
R6479:Mroh7 UTSW 4 106703188 missense possibly damaging 0.75
R6520:Mroh7 UTSW 4 106721263 missense probably benign 0.00
R6657:Mroh7 UTSW 4 106702500 nonsense probably null
R6732:Mroh7 UTSW 4 106680713 frame shift probably null
R6817:Mroh7 UTSW 4 106714115 missense probably benign 0.00
R6980:Mroh7 UTSW 4 106700237 missense probably benign 0.05
R7062:Mroh7 UTSW 4 106683980 missense probably damaging 1.00
R7116:Mroh7 UTSW 4 106711320 missense probably benign 0.07
R7134:Mroh7 UTSW 4 106720594 missense probably damaging 0.99
R7169:Mroh7 UTSW 4 106691639 missense probably damaging 0.99
R7419:Mroh7 UTSW 4 106683918 missense probably benign
R7525:Mroh7 UTSW 4 106709702 missense probably benign 0.22
R7540:Mroh7 UTSW 4 106720398 missense possibly damaging 0.85
R7849:Mroh7 UTSW 4 106721090 missense probably benign
R7920:Mroh7 UTSW 4 106707576 missense probably benign
R7998:Mroh7 UTSW 4 106711281 missense probably benign 0.02
R8026:Mroh7 UTSW 4 106721437 missense probably benign 0.01
R8122:Mroh7 UTSW 4 106702529 missense probably damaging 0.96
R8249:Mroh7 UTSW 4 106721212 missense probably benign 0.00
R9188:Mroh7 UTSW 4 106709592 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTATAAAGGAGGTGCCCTTCAG -3'
(R):5'- CACTGGGTAGCCTAATGGTG -3'

Sequencing Primer
(F):5'- TTCAGGGCCTGACAGCAG -3'
(R):5'- GTGAGCACCTAACTTAGACTCAGTG -3'
Posted On 2019-10-17