Incidental Mutation 'R7516:Clip1'
ID582449
Institutional Source Beutler Lab
Gene Symbol Clip1
Ensembl Gene ENSMUSG00000049550
Gene NameCAP-GLY domain containing linker protein 1
SynonymsClip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7516 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location123577795-123684618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123583385 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1149 (V1149A)
Ref Sequence ENSEMBL: ENSMUSP00000107190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566]
PDB Structure
Solution structure of the 1st CAP-Gly domain in mouse CLIP-170/restin [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000031382
AA Change: V1271A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: V1271A

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.28e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.28e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 451 N/A INTRINSIC
coiled coil region 474 535 N/A INTRINSIC
coiled coil region 581 620 N/A INTRINSIC
coiled coil region 652 1352 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
Pfam:CLIP1_ZNF 1375 1392 5.8e-9 PFAM
ZnF_C2HC 1417 1433 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063905
AA Change: V1152A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: V1152A

DomainStartEndE-ValueType
internal_repeat_2 11 53 3.3e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 3.3e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1075 N/A INTRINSIC
coiled coil region 1115 1235 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
ZnF_C2HC 1300 1316 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111561
AA Change: V1260A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: V1260A

DomainStartEndE-ValueType
internal_repeat_2 11 53 1.93e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 1.93e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1341 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
ZnF_C2HC 1406 1422 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111564
AA Change: V1149A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: V1149A

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.5e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.5e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1230 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
ZnF_C2HC 1295 1311 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111566
AA Change: V1225A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: V1225A

DomainStartEndE-ValueType
internal_repeat_2 11 53 2e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1306 N/A INTRINSIC
low complexity region 1316 1327 N/A INTRINSIC
ZnF_C2HC 1371 1387 1.45e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550
AA Change: V897A

DomainStartEndE-ValueType
CAP_GLY 2 31 2.59e0 SMART
low complexity region 39 57 N/A INTRINSIC
low complexity region 58 84 N/A INTRINSIC
coiled coil region 101 276 N/A INTRINSIC
coiled coil region 322 361 N/A INTRINSIC
coiled coil region 393 980 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Pfam:CLIP1_ZNF 1004 1021 4.2e-9 PFAM
ZnF_C2HC 1046 1062 1.45e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122064
Gene: ENSMUSG00000049550
AA Change: V1072A

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 165 176 N/A INTRINSIC
internal_repeat_1 352 375 1.56e-8 PROSPERO
internal_repeat_3 358 377 5.32e-6 PROSPERO
internal_repeat_1 450 473 1.56e-8 PROSPERO
internal_repeat_3 544 563 5.32e-6 PROSPERO
internal_repeat_2 553 575 2.88e-7 PROSPERO
low complexity region 735 744 N/A INTRINSIC
internal_repeat_2 781 803 2.88e-7 PROSPERO
low complexity region 819 830 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1081 1099 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1164 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,630,676 I407F probably damaging Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Alkbh5 T C 11: 60,539,153 V244A probably damaging Het
Arap1 T C 7: 101,409,331 F1390L probably benign Het
Asph T C 4: 9,630,940 D136G possibly damaging Het
Atp8a2 A T 14: 59,857,067 Y841N probably damaging Het
Cald1 A T 6: 34,709,557 probably benign Het
Capn11 A G 17: 45,638,840 I400T possibly damaging Het
Cdh18 T A 15: 23,259,598 probably null Het
Ces2h T A 8: 105,016,826 L204Q probably damaging Het
Chrna3 G A 9: 55,015,369 A385V probably benign Het
Clca4a A T 3: 144,966,248 L311Q probably damaging Het
Clip3 T A 7: 30,298,843 V238D possibly damaging Het
Col12a1 A G 9: 79,612,910 probably null Het
Coro2a A G 4: 46,562,992 V54A probably benign Het
Crem T C 18: 3,299,141 probably null Het
Dennd5b T C 6: 149,068,380 I192V probably benign Het
Dst A G 1: 34,170,479 N1209S probably benign Het
Ero1l T A 14: 45,288,023 M385L probably benign Het
Fam13a A T 6: 58,955,263 V375D probably damaging Het
Fgfbp3 T A 19: 36,918,924 Y98F possibly damaging Het
Frem3 T C 8: 80,612,083 V335A probably damaging Het
Gm19410 T A 8: 35,796,279 D951E probably benign Het
Gpatch1 T C 7: 35,308,200 D145G probably benign Het
H60c G T 10: 3,259,746 C180* probably null Het
Hmcn1 T C 1: 150,622,967 T4054A probably benign Het
Hrg A G 16: 22,961,298 Y442C unknown Het
Hspg2 C T 4: 137,542,620 R2327C possibly damaging Het
Klhl31 G T 9: 77,651,147 A382S probably damaging Het
Knl1 T C 2: 119,070,698 V960A probably damaging Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Me3 G T 7: 89,847,975 E395* probably null Het
Morc2b G A 17: 33,137,461 H446Y probably benign Het
Mroh7 A T 4: 106,691,119 M1054K probably benign Het
Ms4a6b T C 19: 11,529,543 V232A probably benign Het
Nmt2 C A 2: 3,312,730 D224E probably damaging Het
Nox4 C A 7: 87,321,697 R261S probably benign Het
Obscn T A 11: 59,124,590 K1019* probably null Het
Olfr1058 C T 2: 86,385,984 V145I probably benign Het
Olfr1234 T A 2: 89,363,375 N18I probably benign Het
Olfr1288 T A 2: 111,478,937 V51D probably benign Het
Olfr492 G A 7: 108,323,016 S220F probably damaging Het
Pcdha11 A T 18: 37,011,618 N254I probably damaging Het
Pck2 T A 14: 55,542,456 I54N probably benign Het
Pkd1l3 T A 8: 109,635,229 W978R probably damaging Het
Plxna4 T C 6: 32,237,768 T593A probably benign Het
Podn G A 4: 108,022,124 R266W probably damaging Het
Ptpn22 A G 3: 103,885,538 D335G probably benign Het
Pxn A G 5: 115,506,863 D3G unknown Het
Rapgefl1 T G 11: 98,846,134 V320G probably benign Het
Rel A G 11: 23,742,785 I416T probably benign Het
Sema5b A G 16: 35,651,170 N378D probably benign Het
Sh3bp4 C A 1: 89,145,646 L739M probably damaging Het
Skint2 A T 4: 112,625,971 D191V probably damaging Het
Slc3a1 T C 17: 85,063,762 Y581H probably damaging Het
Smcr8 G T 11: 60,779,988 C654F probably benign Het
Spta1 A C 1: 174,197,783 Q738P probably damaging Het
Sptlc3 C A 2: 139,589,518 A320D probably benign Het
Thnsl2 T A 6: 71,132,006 K274* probably null Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmtc4 G A 14: 122,943,323 A326V possibly damaging Het
Tnks2 T A 19: 36,871,664 S179T possibly damaging Het
Trim34b G T 7: 104,329,711 C55F probably damaging Het
Trpm4 T A 7: 45,305,020 E1129V probably damaging Het
Tvp23b T C 11: 62,892,041 S188P possibly damaging Het
Usp1 A G 4: 98,934,119 T557A probably damaging Het
Vmn2r66 C T 7: 85,011,968 C18Y possibly damaging Het
Vmn2r85 T A 10: 130,418,983 T611S probably damaging Het
Vps13c T C 9: 67,955,007 S2969P possibly damaging Het
Wdr74 T A 19: 8,736,190 C62* probably null Het
Wfikkn1 A T 17: 25,878,046 C435S probably damaging Het
Zbtb45 A T 7: 13,006,342 F449I probably damaging Het
Other mutations in Clip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Clip1 APN 5 123603654 missense possibly damaging 0.94
IGL01067:Clip1 APN 5 123630804 missense probably damaging 0.99
IGL01524:Clip1 APN 5 123579379 missense probably damaging 1.00
IGL01632:Clip1 APN 5 123617496 missense probably damaging 1.00
IGL01798:Clip1 APN 5 123583549 missense probably damaging 1.00
IGL01874:Clip1 APN 5 123603666 missense possibly damaging 0.50
IGL01908:Clip1 APN 5 123623207 splice site probably benign
IGL02120:Clip1 APN 5 123647883 missense probably damaging 1.00
IGL02309:Clip1 APN 5 123617700 missense probably damaging 0.99
IGL02555:Clip1 APN 5 123621794 critical splice donor site probably null
IGL03027:Clip1 APN 5 123621856 missense probably benign 0.43
IGL03336:Clip1 APN 5 123653570 nonsense probably null
IGL03365:Clip1 APN 5 123583586 missense probably damaging 1.00
IGL02802:Clip1 UTSW 5 123631123 missense probably damaging 1.00
PIT4812001:Clip1 UTSW 5 123630675 missense probably benign 0.08
R0254:Clip1 UTSW 5 123617332 splice site probably benign
R0401:Clip1 UTSW 5 123653789 missense probably damaging 1.00
R0530:Clip1 UTSW 5 123640531 missense probably damaging 1.00
R0744:Clip1 UTSW 5 123630721 missense probably benign 0.05
R0833:Clip1 UTSW 5 123630721 missense probably benign 0.05
R1116:Clip1 UTSW 5 123579491 missense probably damaging 0.99
R1182:Clip1 UTSW 5 123647865 missense probably damaging 1.00
R1656:Clip1 UTSW 5 123630403 missense possibly damaging 0.61
R1700:Clip1 UTSW 5 123630370 missense probably benign
R1889:Clip1 UTSW 5 123653496 missense probably damaging 0.99
R1975:Clip1 UTSW 5 123623218 missense possibly damaging 0.79
R2406:Clip1 UTSW 5 123603660 missense probably damaging 1.00
R3545:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3547:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3548:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3911:Clip1 UTSW 5 123590834 missense probably damaging 1.00
R3944:Clip1 UTSW 5 123617829 unclassified probably benign
R4660:Clip1 UTSW 5 123579374 missense probably damaging 0.98
R4784:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4785:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4824:Clip1 UTSW 5 123631023 missense probably damaging 1.00
R4831:Clip1 UTSW 5 123583601 missense probably damaging 1.00
R4951:Clip1 UTSW 5 123630345 missense probably benign 0.02
R4960:Clip1 UTSW 5 123654003 nonsense probably null
R5014:Clip1 UTSW 5 123617730 missense probably damaging 0.99
R5116:Clip1 UTSW 5 123630707 missense probably benign 0.05
R5212:Clip1 UTSW 5 123630681 missense probably benign 0.09
R5238:Clip1 UTSW 5 123647883 missense probably damaging 1.00
R5318:Clip1 UTSW 5 123613084 unclassified probably benign
R5372:Clip1 UTSW 5 123630240 missense probably benign 0.02
R5701:Clip1 UTSW 5 123613303 unclassified probably benign
R5734:Clip1 UTSW 5 123615154 unclassified probably benign
R5757:Clip1 UTSW 5 123627397 missense probably benign 0.21
R6024:Clip1 UTSW 5 123615089 missense possibly damaging 0.66
R6160:Clip1 UTSW 5 123613541 missense possibly damaging 0.66
R6177:Clip1 UTSW 5 123613834 unclassified probably benign
R6183:Clip1 UTSW 5 123642604 missense probably damaging 1.00
R6377:Clip1 UTSW 5 123603654 missense possibly damaging 0.50
R6436:Clip1 UTSW 5 123641785 missense probably damaging 1.00
R6471:Clip1 UTSW 5 123640549 missense probably damaging 0.99
R6766:Clip1 UTSW 5 123614764 unclassified probably benign
R7015:Clip1 UTSW 5 123613612 unclassified probably benign
R7094:Clip1 UTSW 5 123623270 missense probably benign 0.02
R7143:Clip1 UTSW 5 123653610 missense probably benign
R7222:Clip1 UTSW 5 123611841 missense probably damaging 0.99
R7233:Clip1 UTSW 5 123611859 missense probably damaging 1.00
R7238:Clip1 UTSW 5 123613265 missense
R7249:Clip1 UTSW 5 123603600 missense probably damaging 1.00
R7283:Clip1 UTSW 5 123613794 missense
R7295:Clip1 UTSW 5 123627356 missense probably benign 0.19
R7447:Clip1 UTSW 5 123653633 missense probably benign 0.03
R7458:Clip1 UTSW 5 123640546 missense probably damaging 1.00
R7483:Clip1 UTSW 5 123617384 missense probably benign 0.00
R7619:Clip1 UTSW 5 123614279 missense
R7831:Clip1 UTSW 5 123613279 missense
R7897:Clip1 UTSW 5 123622798 missense probably benign
R7914:Clip1 UTSW 5 123613279 missense
R7980:Clip1 UTSW 5 123622798 missense probably benign
Z1177:Clip1 UTSW 5 123617350 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACTGAATAGCGATGGGAG -3'
(R):5'- GAAAGCCTCCTTGCAGAAGTCG -3'

Sequencing Primer
(F):5'- CCACTGAATAGCGATGGGAGAAAAG -3'
(R):5'- TCCTTGCAGAAGTCGATCAG -3'
Posted On2019-10-17