Mutagenetix > Incidental Mutation

Incidental Mutation 'R7516:Clip1'

582449

Institutional Source

Beutler Lab

Gene Symbol

Clip1

Ensembl Gene

ENSMUSG00000049550

Gene Name

CAP-GLY domain containing linker protein 1

Synonyms

Clip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50

MMRRC Submission

045589-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123577795-123684618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123583385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1149 (V1149A)

Ref Sequence

ENSEMBL: ENSMUSP00000107190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566]

AlphaFold

Q922J3

PDB Structure

Solution structure of the 1st CAP-Gly domain in mouse CLIP-170/restin [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000031382
AA Change: V1271A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: V1271A

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.28e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.28e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	451	N/A	INTRINSIC
coiled coil region	474	535	N/A	INTRINSIC
coiled coil region	581	620	N/A	INTRINSIC
coiled coil region	652	1352	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1375	1392	5.8e-9	PFAM
ZnF_C2HC	1417	1433	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000063905
AA Change: V1152A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: V1152A

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	3.3e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	3.3e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1075	N/A	INTRINSIC
coiled coil region	1115	1235	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
ZnF_C2HC	1300	1316	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111561
AA Change: V1260A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: V1260A

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	1.93e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	1.93e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1341	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
ZnF_C2HC	1406	1422	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111564
AA Change: V1149A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: V1149A

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.5e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.5e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1230	N/A	INTRINSIC
low complexity region	1240	1251	N/A	INTRINSIC
ZnF_C2HC	1295	1311	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111566
AA Change: V1225A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: V1225A

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1306	N/A	INTRINSIC
low complexity region	1316	1327	N/A	INTRINSIC
ZnF_C2HC	1371	1387	1.45e0	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550
AA Change: V897A

Domain	Start	End	E-Value	Type
CAP_GLY	2	31	2.59e0	SMART
low complexity region	39	57	N/A	INTRINSIC
low complexity region	58	84	N/A	INTRINSIC
coiled coil region	101	276	N/A	INTRINSIC
coiled coil region	322	361	N/A	INTRINSIC
coiled coil region	393	980	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1004	1021	4.2e-9	PFAM
ZnF_C2HC	1046	1062	1.45e0	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122064
Gene: ENSMUSG00000049550
AA Change: V1072A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
low complexity region	165	176	N/A	INTRINSIC
internal_repeat_1	352	375	1.56e-8	PROSPERO
internal_repeat_3	358	377	5.32e-6	PROSPERO
internal_repeat_1	450	473	1.56e-8	PROSPERO
internal_repeat_3	544	563	5.32e-6	PROSPERO
internal_repeat_2	553	575	2.88e-7	PROSPERO
low complexity region	735	744	N/A	INTRINSIC
internal_repeat_2	781	803	2.88e-7	PROSPERO
low complexity region	819	830	N/A	INTRINSIC
low complexity region	962	977	N/A	INTRINSIC
low complexity region	1081	1099	N/A	INTRINSIC
low complexity region	1110	1121	N/A	INTRINSIC
low complexity region	1164	1175	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam28	T	A	14: 68,630,676	I407F	probably damaging	Het
Agbl1	A	G	7: 76,425,921	Y437C	probably damaging	Het
Alkbh5	T	C	11: 60,539,153	V244A	probably damaging	Het
Arap1	T	C	7: 101,409,331	F1390L	probably benign	Het
Asph	T	C	4: 9,630,940	D136G	possibly damaging	Het
Atp8a2	A	T	14: 59,857,067	Y841N	probably damaging	Het
Cald1	A	T	6: 34,709,557		probably benign	Het
Capn11	A	G	17: 45,638,840	I400T	possibly damaging	Het
Cdh18	T	A	15: 23,259,598		probably null	Het
Ces2h	T	A	8: 105,016,826	L204Q	probably damaging	Het
Chrna3	G	A	9: 55,015,369	A385V	probably benign	Het
Clca4a	A	T	3: 144,966,248	L311Q	probably damaging	Het
Clip3	T	A	7: 30,298,843	V238D	possibly damaging	Het
Col12a1	A	G	9: 79,612,910		probably null	Het
Coro2a	A	G	4: 46,562,992	V54A	probably benign	Het
Crem	T	C	18: 3,299,141		probably null	Het
Dennd5b	T	C	6: 149,068,380	I192V	probably benign	Het
Dst	A	G	1: 34,170,479	N1209S	probably benign	Het
Ero1l	T	A	14: 45,288,023	M385L	probably benign	Het
Fam13a	A	T	6: 58,955,263	V375D	probably damaging	Het
Fgfbp3	T	A	19: 36,918,924	Y98F	possibly damaging	Het
Frem3	T	C	8: 80,612,083	V335A	probably damaging	Het
Gm19410	T	A	8: 35,796,279	D951E	probably benign	Het
Gpatch1	T	C	7: 35,308,200	D145G	probably benign	Het
H60c	G	T	10: 3,259,746	C180*	probably null	Het
Hmcn1	T	C	1: 150,622,967	T4054A	probably benign	Het
Hrg	A	G	16: 22,961,298	Y442C	unknown	Het
Hspg2	C	T	4: 137,542,620	R2327C	possibly damaging	Het
Klhl31	G	T	9: 77,651,147	A382S	probably damaging	Het
Knl1	T	C	2: 119,070,698	V960A	probably damaging	Het
Lztr1	C	T	16: 17,509,661	A76V	possibly damaging	Het
Me3	G	T	7: 89,847,975	E395*	probably null	Het
Morc2b	G	A	17: 33,137,461	H446Y	probably benign	Het
Mroh7	A	T	4: 106,691,119	M1054K	probably benign	Het
Ms4a6b	T	C	19: 11,529,543	V232A	probably benign	Het
Nmt2	C	A	2: 3,312,730	D224E	probably damaging	Het
Nox4	C	A	7: 87,321,697	R261S	probably benign	Het
Obscn	T	A	11: 59,124,590	K1019*	probably null	Het
Olfr1058	C	T	2: 86,385,984	V145I	probably benign	Het
Olfr1234	T	A	2: 89,363,375	N18I	probably benign	Het
Olfr1288	T	A	2: 111,478,937	V51D	probably benign	Het
Olfr492	G	A	7: 108,323,016	S220F	probably damaging	Het
Pcdha11	A	T	18: 37,011,618	N254I	probably damaging	Het
Pck2	T	A	14: 55,542,456	I54N	probably benign	Het
Pkd1l3	T	A	8: 109,635,229	W978R	probably damaging	Het
Plxna4	T	C	6: 32,237,768	T593A	probably benign	Het
Podn	G	A	4: 108,022,124	R266W	probably damaging	Het
Ptpn22	A	G	3: 103,885,538	D335G	probably benign	Het
Pxn	A	G	5: 115,506,863	D3G	unknown	Het
Rapgefl1	T	G	11: 98,846,134	V320G	probably benign	Het
Rel	A	G	11: 23,742,785	I416T	probably benign	Het
Sema5b	A	G	16: 35,651,170	N378D	probably benign	Het
Sh3bp4	C	A	1: 89,145,646	L739M	probably damaging	Het
Skint2	A	T	4: 112,625,971	D191V	probably damaging	Het
Slc3a1	T	C	17: 85,063,762	Y581H	probably damaging	Het
Smcr8	G	T	11: 60,779,988	C654F	probably benign	Het
Spta1	A	C	1: 174,197,783	Q738P	probably damaging	Het
Sptlc3	C	A	2: 139,589,518	A320D	probably benign	Het
Thnsl2	T	A	6: 71,132,006	K274*	probably null	Het
Tmed2	T	A	5: 124,546,992	I68K	possibly damaging	Het
Tmtc4	G	A	14: 122,943,323	A326V	possibly damaging	Het
Tnks2	T	A	19: 36,871,664	S179T	possibly damaging	Het
Trim34b	G	T	7: 104,329,711	C55F	probably damaging	Het
Trpm4	T	A	7: 45,305,020	E1129V	probably damaging	Het
Tvp23b	T	C	11: 62,892,041	S188P	possibly damaging	Het
Usp1	A	G	4: 98,934,119	T557A	probably damaging	Het
Vmn2r66	C	T	7: 85,011,968	C18Y	possibly damaging	Het
Vmn2r85	T	A	10: 130,418,983	T611S	probably damaging	Het
Vps13c	T	C	9: 67,955,007	S2969P	possibly damaging	Het
Wdr74	T	A	19: 8,736,190	C62*	probably null	Het
Wfikkn1	A	T	17: 25,878,046	C435S	probably damaging	Het
Zbtb45	A	T	7: 13,006,342	F449I	probably damaging	Het

Other mutations in Clip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Clip1	APN	5	123603654	missense	possibly damaging	0.94
IGL01067:Clip1	APN	5	123630804	missense	probably damaging	0.99
IGL01524:Clip1	APN	5	123579379	missense	probably damaging	1.00
IGL01632:Clip1	APN	5	123617496	missense	probably damaging	1.00
IGL01798:Clip1	APN	5	123583549	missense	probably damaging	1.00
IGL01874:Clip1	APN	5	123603666	missense	possibly damaging	0.50
IGL01908:Clip1	APN	5	123623207	splice site	probably benign
IGL02120:Clip1	APN	5	123647883	missense	probably damaging	1.00
IGL02309:Clip1	APN	5	123617700	missense	probably damaging	0.99
IGL02555:Clip1	APN	5	123621794	critical splice donor site	probably null
IGL03027:Clip1	APN	5	123621856	missense	probably benign	0.43
IGL03336:Clip1	APN	5	123653570	nonsense	probably null
IGL03365:Clip1	APN	5	123583586	missense	probably damaging	1.00
IGL02802:Clip1	UTSW	5	123631123	missense	probably damaging	1.00
PIT4812001:Clip1	UTSW	5	123630675	missense	probably benign	0.08
R0254:Clip1	UTSW	5	123617332	splice site	probably benign
R0401:Clip1	UTSW	5	123653789	missense	probably damaging	1.00
R0530:Clip1	UTSW	5	123640531	missense	probably damaging	1.00
R0744:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R0833:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R1116:Clip1	UTSW	5	123579491	missense	probably damaging	0.99
R1182:Clip1	UTSW	5	123647865	missense	probably damaging	1.00
R1656:Clip1	UTSW	5	123630403	missense	possibly damaging	0.61
R1700:Clip1	UTSW	5	123630370	missense	probably benign
R1889:Clip1	UTSW	5	123653496	missense	probably damaging	0.99
R1975:Clip1	UTSW	5	123623218	missense	possibly damaging	0.79
R2406:Clip1	UTSW	5	123603660	missense	probably damaging	1.00
R3545:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3547:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3548:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3911:Clip1	UTSW	5	123590834	missense	probably damaging	1.00
R3944:Clip1	UTSW	5	123617829	unclassified	probably benign
R4660:Clip1	UTSW	5	123579374	missense	probably damaging	0.98
R4784:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4785:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4824:Clip1	UTSW	5	123631023	missense	probably damaging	1.00
R4831:Clip1	UTSW	5	123583601	missense	probably damaging	1.00
R4951:Clip1	UTSW	5	123630345	missense	probably benign	0.02
R4960:Clip1	UTSW	5	123654003	nonsense	probably null
R5014:Clip1	UTSW	5	123617730	missense	probably damaging	0.99
R5116:Clip1	UTSW	5	123630707	missense	probably benign	0.05
R5212:Clip1	UTSW	5	123630681	missense	probably benign	0.09
R5238:Clip1	UTSW	5	123647883	missense	probably damaging	1.00
R5318:Clip1	UTSW	5	123613084	unclassified	probably benign
R5372:Clip1	UTSW	5	123630240	missense	probably benign	0.02
R5701:Clip1	UTSW	5	123613303	unclassified	probably benign
R5734:Clip1	UTSW	5	123615154	unclassified	probably benign
R5757:Clip1	UTSW	5	123627397	missense	probably benign	0.21
R6024:Clip1	UTSW	5	123615089	missense	possibly damaging	0.66
R6160:Clip1	UTSW	5	123613541	missense	possibly damaging	0.66
R6177:Clip1	UTSW	5	123613834	unclassified	probably benign
R6183:Clip1	UTSW	5	123642604	missense	probably damaging	1.00
R6377:Clip1	UTSW	5	123603654	missense	possibly damaging	0.50
R6436:Clip1	UTSW	5	123641785	missense	probably damaging	1.00
R6471:Clip1	UTSW	5	123640549	missense	probably damaging	0.99
R6766:Clip1	UTSW	5	123614764	unclassified	probably benign
R7015:Clip1	UTSW	5	123613612	unclassified	probably benign
R7094:Clip1	UTSW	5	123623270	missense	probably benign	0.02
R7143:Clip1	UTSW	5	123653610	missense	probably benign
R7222:Clip1	UTSW	5	123611841	missense	probably damaging	0.99
R7233:Clip1	UTSW	5	123611859	missense	probably damaging	1.00
R7238:Clip1	UTSW	5	123613265	missense
R7249:Clip1	UTSW	5	123603600	missense	probably damaging	1.00
R7283:Clip1	UTSW	5	123613794	missense
R7295:Clip1	UTSW	5	123627356	missense	probably benign	0.19
R7447:Clip1	UTSW	5	123653633	missense	probably benign	0.03
R7458:Clip1	UTSW	5	123640546	missense	probably damaging	1.00
R7483:Clip1	UTSW	5	123617384	missense	probably benign	0.00
R7619:Clip1	UTSW	5	123614279	missense
R7831:Clip1	UTSW	5	123613279	missense
R7897:Clip1	UTSW	5	123622798	missense	probably benign
R8155:Clip1	UTSW	5	123613636	missense
R8157:Clip1	UTSW	5	123630719	missense	probably benign	0.17
R8232:Clip1	UTSW	5	123647918	missense	probably benign	0.05
R8396:Clip1	UTSW	5	123642564	missense	probably damaging	1.00
R8446:Clip1	UTSW	5	123655945	missense	probably damaging	1.00
R8486:Clip1	UTSW	5	123614707	unclassified	probably benign
R8511:Clip1	UTSW	5	123653906	missense	possibly damaging	0.50
R8731:Clip1	UTSW	5	123614693	missense
R8889:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R8892:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R9058:Clip1	UTSW	5	123614582	missense
R9106:Clip1	UTSW	5	123615160	missense	probably damaging	0.97
R9212:Clip1	UTSW	5	123583336	missense	probably damaging	1.00
R9217:Clip1	UTSW	5	123579378	missense	probably damaging	1.00
R9223:Clip1	UTSW	5	123646274	missense	probably damaging	1.00
R9325:Clip1	UTSW	5	123613123	missense
R9752:Clip1	UTSW	5	123621946	missense	probably damaging	1.00
Z1177:Clip1	UTSW	5	123617350	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCACTGAATAGCGATGGGAG -3'
(R):5'- GAAAGCCTCCTTGCAGAAGTCG -3'

Sequencing Primer
(F):5'- CCACTGAATAGCGATGGGAGAAAAG -3'
(R):5'- TCCTTGCAGAAGTCGATCAG -3'

Posted On

2019-10-17