Mutagenetix > Incidental Mutations

Incidental Mutation 'R7516:Agbl1'

582460

Institutional Source

Beutler Lab

Gene Symbol

Agbl1

Ensembl Gene

ENSMUSG00000025754

Gene Name

ATP/GTP binding protein-like 1

Synonyms

Nna1-l1, EG244071

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76229887-77124698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76425921 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 437 (Y437C)

Ref Sequence

ENSEMBL: ENSMUSP00000103066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026854
AA Change: Y437C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: Y437C

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	493	631	4.4e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107442
AA Change: Y437C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: Y437C

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	494	754	3.1e-27	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000156166
AA Change: Y689C

SMART Domains

Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: Y689C

Domain	Start	End	E-Value	Type
low complexity region	254	270	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam28	T	A	14: 68,630,676	I407F	probably damaging	Het
Alkbh5	T	C	11: 60,539,153	V244A	probably damaging	Het
Arap1	T	C	7: 101,409,331	F1390L	probably benign	Het
Asph	T	C	4: 9,630,940	D136G	possibly damaging	Het
Atp8a2	A	T	14: 59,857,067	Y841N	probably damaging	Het
Cald1	A	T	6: 34,709,557		probably benign	Het
Capn11	A	G	17: 45,638,840	I400T	possibly damaging	Het
Cdh18	T	A	15: 23,259,598		probably null	Het
Ces2h	T	A	8: 105,016,826	L204Q	probably damaging	Het
Chrna3	G	A	9: 55,015,369	A385V	probably benign	Het
Clca4a	A	T	3: 144,966,248	L311Q	probably damaging	Het
Clip1	A	G	5: 123,583,385	V1149A	probably benign	Het
Clip3	T	A	7: 30,298,843	V238D	possibly damaging	Het
Col12a1	A	G	9: 79,612,910		probably null	Het
Coro2a	A	G	4: 46,562,992	V54A	probably benign	Het
Crem	T	C	18: 3,299,141		probably null	Het
Dennd5b	T	C	6: 149,068,380	I192V	probably benign	Het
Dst	A	G	1: 34,170,479	N1209S	probably benign	Het
Ero1l	T	A	14: 45,288,023	M385L	probably benign	Het
Fam13a	A	T	6: 58,955,263	V375D	probably damaging	Het
Fgfbp3	T	A	19: 36,918,924	Y98F	possibly damaging	Het
Frem3	T	C	8: 80,612,083	V335A	probably damaging	Het
Gm19410	T	A	8: 35,796,279	D951E	probably benign	Het
Gpatch1	T	C	7: 35,308,200	D145G	probably benign	Het
H60c	G	T	10: 3,259,746	C180*	probably null	Het
Hmcn1	T	C	1: 150,622,967	T4054A	probably benign	Het
Hrg	A	G	16: 22,961,298	Y442C	unknown	Het
Hspg2	C	T	4: 137,542,620	R2327C	possibly damaging	Het
Klhl31	G	T	9: 77,651,147	A382S	probably damaging	Het
Knl1	T	C	2: 119,070,698	V960A	probably damaging	Het
Lztr1	C	T	16: 17,509,661	A76V	possibly damaging	Het
Me3	G	T	7: 89,847,975	E395*	probably null	Het
Morc2b	G	A	17: 33,137,461	H446Y	probably benign	Het
Mroh7	A	T	4: 106,691,119	M1054K	probably benign	Het
Ms4a6b	T	C	19: 11,529,543	V232A	probably benign	Het
Nmt2	C	A	2: 3,312,730	D224E	probably damaging	Het
Nox4	C	A	7: 87,321,697	R261S	probably benign	Het
Obscn	T	A	11: 59,124,590	K1019*	probably null	Het
Olfr1058	C	T	2: 86,385,984	V145I	probably benign	Het
Olfr1234	T	A	2: 89,363,375	N18I	probably benign	Het
Olfr1288	T	A	2: 111,478,937	V51D	probably benign	Het
Olfr492	G	A	7: 108,323,016	S220F	probably damaging	Het
Pcdha11	A	T	18: 37,011,618	N254I	probably damaging	Het
Pck2	T	A	14: 55,542,456	I54N	probably benign	Het
Pkd1l3	T	A	8: 109,635,229	W978R	probably damaging	Het
Plxna4	T	C	6: 32,237,768	T593A	probably benign	Het
Podn	G	A	4: 108,022,124	R266W	probably damaging	Het
Ptpn22	A	G	3: 103,885,538	D335G	probably benign	Het
Pxn	A	G	5: 115,506,863	D3G	unknown	Het
Rapgefl1	T	G	11: 98,846,134	V320G	probably benign	Het
Rel	A	G	11: 23,742,785	I416T	probably benign	Het
Sema5b	A	G	16: 35,651,170	N378D	probably benign	Het
Sh3bp4	C	A	1: 89,145,646	L739M	probably damaging	Het
Skint2	A	T	4: 112,625,971	D191V	probably damaging	Het
Slc3a1	T	C	17: 85,063,762	Y581H	probably damaging	Het
Smcr8	G	T	11: 60,779,988	C654F	probably benign	Het
Spta1	A	C	1: 174,197,783	Q738P	probably damaging	Het
Sptlc3	C	A	2: 139,589,518	A320D	probably benign	Het
Thnsl2	T	A	6: 71,132,006	K274*	probably null	Het
Tmed2	T	A	5: 124,546,992	I68K	possibly damaging	Het
Tmtc4	G	A	14: 122,943,323	A326V	possibly damaging	Het
Tnks2	T	A	19: 36,871,664	S179T	possibly damaging	Het
Trim34b	G	T	7: 104,329,711	C55F	probably damaging	Het
Trpm4	T	A	7: 45,305,020	E1129V	probably damaging	Het
Tvp23b	T	C	11: 62,892,041	S188P	possibly damaging	Het
Usp1	A	G	4: 98,934,119	T557A	probably damaging	Het
Vmn2r66	C	T	7: 85,011,968	C18Y	possibly damaging	Het
Vmn2r85	T	A	10: 130,418,983	T611S	probably damaging	Het
Vps13c	T	C	9: 67,955,007	S2969P	possibly damaging	Het
Wdr74	T	A	19: 8,736,190	C62*	probably null	Het
Wfikkn1	A	T	17: 25,878,046	C435S	probably damaging	Het
Zbtb45	A	T	7: 13,006,342	F449I	probably damaging	Het

Other mutations in Agbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01567:Agbl1	APN	7	76421880	missense	probably benign	0.01
IGL01650:Agbl1	APN	7	76420319	missense	probably damaging	1.00
IGL02244:Agbl1	APN	7	76766372	missense	probably damaging	1.00
IGL03088:Agbl1	APN	7	76720142	missense	probably benign	0.12
IGL03143:Agbl1	APN	7	76420045	nonsense	probably null
IGL03306:Agbl1	APN	7	76589504	missense	probably damaging	1.00
R0001:Agbl1	UTSW	7	76419863	missense	probably damaging	0.98
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0541:Agbl1	UTSW	7	76409245	missense	probably benign	0.22
R1889:Agbl1	UTSW	7	76589381	missense	probably damaging	1.00
R2089:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2127:Agbl1	UTSW	7	76419880	missense	possibly damaging	0.64
R2148:Agbl1	UTSW	7	76414717	splice site	probably null
R2229:Agbl1	UTSW	7	76433378	missense	probably benign	0.43
R2243:Agbl1	UTSW	7	76418722	missense	possibly damaging	0.93
R2255:Agbl1	UTSW	7	76422184	missense	probably damaging	1.00
R2411:Agbl1	UTSW	7	76720150	missense	probably damaging	1.00
R2426:Agbl1	UTSW	7	76421902	missense	probably damaging	1.00
R2508:Agbl1	UTSW	7	76589550	critical splice donor site	probably null
R2910:Agbl1	UTSW	7	76419838	missense	probably benign	0.13
R2919:Agbl1	UTSW	7	76414658	missense	probably damaging	1.00
R3056:Agbl1	UTSW	7	76766484	missense	possibly damaging	0.60
R3153:Agbl1	UTSW	7	76720196	missense	probably damaging	1.00
R3770:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R3825:Agbl1	UTSW	7	76419967	missense	probably damaging	0.99
R4632:Agbl1	UTSW	7	76413685	missense	probably benign	0.00
R4857:Agbl1	UTSW	7	76419835	missense	probably benign	0.03
R4943:Agbl1	UTSW	7	76420016	missense	probably benign	0.01
R5055:Agbl1	UTSW	7	76413577	missense	probably damaging	1.00
R5071:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5072:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5074:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5095:Agbl1	UTSW	7	76720133	missense	probably damaging	0.96
R5133:Agbl1	UTSW	7	76422156	missense	probably benign	0.21
R5576:Agbl1	UTSW	7	76335237	missense	probably benign	0.03
R5665:Agbl1	UTSW	7	76589503	missense	probably damaging	1.00
R5849:Agbl1	UTSW	7	76325098	missense	probably benign	0.35
R5924:Agbl1	UTSW	7	76409234	missense	probably benign	0.12
R6044:Agbl1	UTSW	7	76318120	missense	possibly damaging	0.56
R6117:Agbl1	UTSW	7	76698786	missense	probably damaging	1.00
R6144:Agbl1	UTSW	7	76420084	missense	probably benign	0.02
R6368:Agbl1	UTSW	7	76419830	missense	probably benign	0.25
R6806:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7455:Agbl1	UTSW	7	76424755	missense	unknown
R7459:Agbl1	UTSW	7	76420066	missense	not run
R7485:Agbl1	UTSW	7	76589493	missense	unknown
R7539:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R7561:Agbl1	UTSW	7	76698761	missense	unknown
R7630:Agbl1	UTSW	7	76886156	missense	unknown
R7655:Agbl1	UTSW	7	76409332	missense
R7656:Agbl1	UTSW	7	76409332	missense
R7658:Agbl1	UTSW	7	76766369	missense	unknown
R7681:Agbl1	UTSW	7	76444901	missense	unknown
R7694:Agbl1	UTSW	7	76698765	missense	unknown
R7773:Agbl1	UTSW	7	76698837	missense	unknown
R7981:Agbl1	UTSW	7	76444840	missense	unknown
R8208:Agbl1	UTSW	7	76720168	missense	unknown
R8317:Agbl1	UTSW	7	76422181	missense	unknown
R8406:Agbl1	UTSW	7	76418667	missense
R8432:Agbl1	UTSW	7	77124686	missense	unknown
Z1088:Agbl1	UTSW	7	76419904	missense	probably benign	0.00
Z1176:Agbl1	UTSW	7	76418685	missense
Z1177:Agbl1	UTSW	7	76720206	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GACAAAATGTGAGCCTTAACTCTTG -3'
(R):5'- TCAGGGGACTAATGCAAGTTC -3'

Sequencing Primer
(F):5'- CCTCATAAGGGCATCAGTGGTTAC -3'
(R):5'- GCAAACAAACAGGTTGTGG -3'

Posted On

2019-10-17