Incidental Mutation 'R7516:Frem3'
ID582468
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7516 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80612083 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 335 (V335A)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: V335A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: V335A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,630,676 I407F probably damaging Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Alkbh5 T C 11: 60,539,153 V244A probably damaging Het
Arap1 T C 7: 101,409,331 F1390L probably benign Het
Asph T C 4: 9,630,940 D136G possibly damaging Het
Atp8a2 A T 14: 59,857,067 Y841N probably damaging Het
Cald1 A T 6: 34,709,557 probably benign Het
Capn11 A G 17: 45,638,840 I400T possibly damaging Het
Cdh18 T A 15: 23,259,598 probably null Het
Ces2h T A 8: 105,016,826 L204Q probably damaging Het
Chrna3 G A 9: 55,015,369 A385V probably benign Het
Clca4a A T 3: 144,966,248 L311Q probably damaging Het
Clip1 A G 5: 123,583,385 V1149A probably benign Het
Clip3 T A 7: 30,298,843 V238D possibly damaging Het
Col12a1 A G 9: 79,612,910 probably null Het
Coro2a A G 4: 46,562,992 V54A probably benign Het
Crem T C 18: 3,299,141 probably null Het
Dennd5b T C 6: 149,068,380 I192V probably benign Het
Dst A G 1: 34,170,479 N1209S probably benign Het
Ero1l T A 14: 45,288,023 M385L probably benign Het
Fam13a A T 6: 58,955,263 V375D probably damaging Het
Fgfbp3 T A 19: 36,918,924 Y98F possibly damaging Het
Gm19410 T A 8: 35,796,279 D951E probably benign Het
Gpatch1 T C 7: 35,308,200 D145G probably benign Het
H60c G T 10: 3,259,746 C180* probably null Het
Hmcn1 T C 1: 150,622,967 T4054A probably benign Het
Hrg A G 16: 22,961,298 Y442C unknown Het
Hspg2 C T 4: 137,542,620 R2327C possibly damaging Het
Klhl31 G T 9: 77,651,147 A382S probably damaging Het
Knl1 T C 2: 119,070,698 V960A probably damaging Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Me3 G T 7: 89,847,975 E395* probably null Het
Morc2b G A 17: 33,137,461 H446Y probably benign Het
Mroh7 A T 4: 106,691,119 M1054K probably benign Het
Ms4a6b T C 19: 11,529,543 V232A probably benign Het
Nmt2 C A 2: 3,312,730 D224E probably damaging Het
Nox4 C A 7: 87,321,697 R261S probably benign Het
Obscn T A 11: 59,124,590 K1019* probably null Het
Olfr1058 C T 2: 86,385,984 V145I probably benign Het
Olfr1234 T A 2: 89,363,375 N18I probably benign Het
Olfr1288 T A 2: 111,478,937 V51D probably benign Het
Olfr492 G A 7: 108,323,016 S220F probably damaging Het
Pcdha11 A T 18: 37,011,618 N254I probably damaging Het
Pck2 T A 14: 55,542,456 I54N probably benign Het
Pkd1l3 T A 8: 109,635,229 W978R probably damaging Het
Plxna4 T C 6: 32,237,768 T593A probably benign Het
Podn G A 4: 108,022,124 R266W probably damaging Het
Ptpn22 A G 3: 103,885,538 D335G probably benign Het
Pxn A G 5: 115,506,863 D3G unknown Het
Rapgefl1 T G 11: 98,846,134 V320G probably benign Het
Rel A G 11: 23,742,785 I416T probably benign Het
Sema5b A G 16: 35,651,170 N378D probably benign Het
Sh3bp4 C A 1: 89,145,646 L739M probably damaging Het
Skint2 A T 4: 112,625,971 D191V probably damaging Het
Slc3a1 T C 17: 85,063,762 Y581H probably damaging Het
Smcr8 G T 11: 60,779,988 C654F probably benign Het
Spta1 A C 1: 174,197,783 Q738P probably damaging Het
Sptlc3 C A 2: 139,589,518 A320D probably benign Het
Thnsl2 T A 6: 71,132,006 K274* probably null Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmtc4 G A 14: 122,943,323 A326V possibly damaging Het
Tnks2 T A 19: 36,871,664 S179T possibly damaging Het
Trim34b G T 7: 104,329,711 C55F probably damaging Het
Trpm4 T A 7: 45,305,020 E1129V probably damaging Het
Tvp23b T C 11: 62,892,041 S188P possibly damaging Het
Usp1 A G 4: 98,934,119 T557A probably damaging Het
Vmn2r66 C T 7: 85,011,968 C18Y possibly damaging Het
Vmn2r85 T A 10: 130,418,983 T611S probably damaging Het
Vps13c T C 9: 67,955,007 S2969P possibly damaging Het
Wdr74 T A 19: 8,736,190 C62* probably null Het
Wfikkn1 A T 17: 25,878,046 C435S probably damaging Het
Zbtb45 A T 7: 13,006,342 F449I probably damaging Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 splice site probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R7976:Frem3 UTSW 8 80611602 nonsense probably null
R8171:Frem3 UTSW 8 80615240 missense probably damaging 1.00
R8185:Frem3 UTSW 8 80612304 nonsense probably null
R8306:Frem3 UTSW 8 80612211 missense possibly damaging 0.95
R8518:Frem3 UTSW 8 80612595 missense probably damaging 1.00
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGACCAGAGTCACAAGGTAC -3'
(R):5'- TTTGAGCTGAAAGACGTGGTC -3'

Sequencing Primer
(F):5'- CCAGAGTCACAAGGTACTAGGTC -3'
(R):5'- AAAGACGTGGTCCCCTTCTGAG -3'
Posted On2019-10-17