Mutagenetix > Incidental Mutation

Incidental Mutation 'R7516:Vps13c'

582472

Institutional Source

Beutler Lab

Gene Symbol

Vps13c

Ensembl Gene

ENSMUSG00000035284

Gene Name

vacuolar protein sorting 13C

Synonyms

C230055H22Rik

MMRRC Submission

Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67840396-67995638 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67955007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2969 (S2969P)

Ref Sequence

ENSEMBL: ENSMUSP00000077040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077879]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077879
AA Change: S2969P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: S2969P

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam28	T	A	14: 68,630,676	I407F	probably damaging	Het
Agbl1	A	G	7: 76,425,921	Y437C	probably damaging	Het
Alkbh5	T	C	11: 60,539,153	V244A	probably damaging	Het
Arap1	T	C	7: 101,409,331	F1390L	probably benign	Het
Asph	T	C	4: 9,630,940	D136G	possibly damaging	Het
Atp8a2	A	T	14: 59,857,067	Y841N	probably damaging	Het
Cald1	A	T	6: 34,709,557		probably benign	Het
Capn11	A	G	17: 45,638,840	I400T	possibly damaging	Het
Cdh18	T	A	15: 23,259,598		probably null	Het
Ces2h	T	A	8: 105,016,826	L204Q	probably damaging	Het
Chrna3	G	A	9: 55,015,369	A385V	probably benign	Het
Clca4a	A	T	3: 144,966,248	L311Q	probably damaging	Het
Clip1	A	G	5: 123,583,385	V1149A	probably benign	Het
Clip3	T	A	7: 30,298,843	V238D	possibly damaging	Het
Col12a1	A	G	9: 79,612,910		probably null	Het
Coro2a	A	G	4: 46,562,992	V54A	probably benign	Het
Crem	T	C	18: 3,299,141		probably null	Het
Dennd5b	T	C	6: 149,068,380	I192V	probably benign	Het
Dst	A	G	1: 34,170,479	N1209S	probably benign	Het
Ero1l	T	A	14: 45,288,023	M385L	probably benign	Het
Fam13a	A	T	6: 58,955,263	V375D	probably damaging	Het
Fgfbp3	T	A	19: 36,918,924	Y98F	possibly damaging	Het
Frem3	T	C	8: 80,612,083	V335A	probably damaging	Het
Gm19410	T	A	8: 35,796,279	D951E	probably benign	Het
Gpatch1	T	C	7: 35,308,200	D145G	probably benign	Het
H60c	G	T	10: 3,259,746	C180*	probably null	Het
Hmcn1	T	C	1: 150,622,967	T4054A	probably benign	Het
Hrg	A	G	16: 22,961,298	Y442C	unknown	Het
Hspg2	C	T	4: 137,542,620	R2327C	possibly damaging	Het
Klhl31	G	T	9: 77,651,147	A382S	probably damaging	Het
Knl1	T	C	2: 119,070,698	V960A	probably damaging	Het
Lztr1	C	T	16: 17,509,661	A76V	possibly damaging	Het
Me3	G	T	7: 89,847,975	E395*	probably null	Het
Morc2b	G	A	17: 33,137,461	H446Y	probably benign	Het
Mroh7	A	T	4: 106,691,119	M1054K	probably benign	Het
Ms4a6b	T	C	19: 11,529,543	V232A	probably benign	Het
Nmt2	C	A	2: 3,312,730	D224E	probably damaging	Het
Nox4	C	A	7: 87,321,697	R261S	probably benign	Het
Obscn	T	A	11: 59,124,590	K1019*	probably null	Het
Olfr1058	C	T	2: 86,385,984	V145I	probably benign	Het
Olfr1234	T	A	2: 89,363,375	N18I	probably benign	Het
Olfr1288	T	A	2: 111,478,937	V51D	probably benign	Het
Olfr492	G	A	7: 108,323,016	S220F	probably damaging	Het
Pcdha11	A	T	18: 37,011,618	N254I	probably damaging	Het
Pck2	T	A	14: 55,542,456	I54N	probably benign	Het
Pkd1l3	T	A	8: 109,635,229	W978R	probably damaging	Het
Plxna4	T	C	6: 32,237,768	T593A	probably benign	Het
Podn	G	A	4: 108,022,124	R266W	probably damaging	Het
Ptpn22	A	G	3: 103,885,538	D335G	probably benign	Het
Pxn	A	G	5: 115,506,863	D3G	unknown	Het
Rapgefl1	T	G	11: 98,846,134	V320G	probably benign	Het
Rel	A	G	11: 23,742,785	I416T	probably benign	Het
Sema5b	A	G	16: 35,651,170	N378D	probably benign	Het
Sh3bp4	C	A	1: 89,145,646	L739M	probably damaging	Het
Skint2	A	T	4: 112,625,971	D191V	probably damaging	Het
Slc3a1	T	C	17: 85,063,762	Y581H	probably damaging	Het
Smcr8	G	T	11: 60,779,988	C654F	probably benign	Het
Spta1	A	C	1: 174,197,783	Q738P	probably damaging	Het
Sptlc3	C	A	2: 139,589,518	A320D	probably benign	Het
Thnsl2	T	A	6: 71,132,006	K274*	probably null	Het
Tmed2	T	A	5: 124,546,992	I68K	possibly damaging	Het
Tmtc4	G	A	14: 122,943,323	A326V	possibly damaging	Het
Tnks2	T	A	19: 36,871,664	S179T	possibly damaging	Het
Trim34b	G	T	7: 104,329,711	C55F	probably damaging	Het
Trpm4	T	A	7: 45,305,020	E1129V	probably damaging	Het
Tvp23b	T	C	11: 62,892,041	S188P	possibly damaging	Het
Usp1	A	G	4: 98,934,119	T557A	probably damaging	Het
Vmn2r66	C	T	7: 85,011,968	C18Y	possibly damaging	Het
Vmn2r85	T	A	10: 130,418,983	T611S	probably damaging	Het
Wdr74	T	A	19: 8,736,190	C62*	probably null	Het
Wfikkn1	A	T	17: 25,878,046	C435S	probably damaging	Het
Zbtb45	A	T	7: 13,006,342	F449I	probably damaging	Het

Other mutations in Vps13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Vps13c	APN	9	67945999	missense	probably benign	0.20
IGL00336:Vps13c	APN	9	67945942	missense	probably benign	0.01
IGL00418:Vps13c	APN	9	67876262	missense	probably damaging	1.00
IGL00481:Vps13c	APN	9	67860865	missense	probably damaging	1.00
IGL00491:Vps13c	APN	9	67893136	missense	probably damaging	1.00
IGL00558:Vps13c	APN	9	67937857	missense	possibly damaging	0.52
IGL00811:Vps13c	APN	9	67948181	missense	probably damaging	0.99
IGL01011:Vps13c	APN	9	67926955	missense	probably damaging	0.98
IGL01094:Vps13c	APN	9	67886284	missense	probably damaging	1.00
IGL01330:Vps13c	APN	9	67964108	missense	probably damaging	1.00
IGL01402:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01404:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01470:Vps13c	APN	9	67912927	splice site	probably benign
IGL01615:Vps13c	APN	9	67955781	missense	probably benign	0.01
IGL01694:Vps13c	APN	9	67895349	missense	probably damaging	1.00
IGL01752:Vps13c	APN	9	67948228	missense	probably damaging	1.00
IGL01810:Vps13c	APN	9	67955780	missense	probably benign
IGL01954:Vps13c	APN	9	67969298	missense	probably damaging	0.98
IGL01978:Vps13c	APN	9	67930643	missense	probably benign	0.03
IGL01998:Vps13c	APN	9	67955068	splice site	probably null
IGL02201:Vps13c	APN	9	67967136	missense	probably damaging	1.00
IGL02205:Vps13c	APN	9	67883454	missense	probably damaging	1.00
IGL02303:Vps13c	APN	9	67945481	splice site	probably benign
IGL02322:Vps13c	APN	9	67937901	missense	probably benign	0.02
IGL02456:Vps13c	APN	9	67952976	missense	probably damaging	1.00
IGL02474:Vps13c	APN	9	67937876	missense	probably benign	0.00
IGL02547:Vps13c	APN	9	67908019	missense	possibly damaging	0.83
IGL02640:Vps13c	APN	9	67886248	splice site	probably benign
IGL02673:Vps13c	APN	9	67878098	missense	probably damaging	1.00
IGL02721:Vps13c	APN	9	67964149	splice site	probably benign
IGL02834:Vps13c	APN	9	67937855	missense	probably benign
IGL02838:Vps13c	APN	9	67975851	missense	probably damaging	1.00
IGL03136:Vps13c	APN	9	67950310	missense	probably damaging	1.00
IGL03137:Vps13c	APN	9	67890380	missense	probably damaging	1.00
IGL03214:Vps13c	APN	9	67897195	missense	probably null	0.81
IGL03240:Vps13c	APN	9	67955047	missense	probably benign
IGL03303:Vps13c	APN	9	67934504	missense	probably benign	0.27
IGL03336:Vps13c	APN	9	67951642	missense	possibly damaging	0.76
IGL03366:Vps13c	APN	9	67946026	missense	probably benign	0.00
diversion	UTSW	9	67910233	missense	possibly damaging	0.93
introversion	UTSW	9	67944046	missense	probably damaging	0.98
Inversion	UTSW	9	67902839	critical splice acceptor site	probably null
subversion	UTSW	9	67908052	missense	probably damaging	1.00
Transversion	UTSW	9	67934501	missense	probably damaging	0.98
3-1:Vps13c	UTSW	9	67936373	missense	probably benign	0.00
IGL02991:Vps13c	UTSW	9	67913877	missense	probably damaging	1.00
PIT4802001:Vps13c	UTSW	9	67937786	missense	probably damaging	1.00
R0008:Vps13c	UTSW	9	67919262	missense	probably benign
R0206:Vps13c	UTSW	9	67939162	splice site	probably benign
R0288:Vps13c	UTSW	9	67927366	missense	probably damaging	0.99
R0324:Vps13c	UTSW	9	67964309	missense	possibly damaging	0.95
R0347:Vps13c	UTSW	9	67910233	missense	possibly damaging	0.93
R0374:Vps13c	UTSW	9	67886246	splice site	probably benign
R0388:Vps13c	UTSW	9	67922915	splice site	probably benign
R0409:Vps13c	UTSW	9	67951644	missense	probably benign	0.00
R0440:Vps13c	UTSW	9	67972861	missense	probably damaging	1.00
R0513:Vps13c	UTSW	9	67930735	missense	probably benign	0.02
R0520:Vps13c	UTSW	9	67945851	missense	possibly damaging	0.88
R0569:Vps13c	UTSW	9	67973719	missense	probably damaging	0.98
R0601:Vps13c	UTSW	9	67927472	missense	probably benign	0.12
R0659:Vps13c	UTSW	9	67920935	missense	probably benign	0.11
R0667:Vps13c	UTSW	9	67951573	nonsense	probably null
R0670:Vps13c	UTSW	9	67925857	missense	probably benign	0.35
R0698:Vps13c	UTSW	9	67889723	missense	probably benign	0.45
R0729:Vps13c	UTSW	9	67961649	missense	probably damaging	1.00
R0781:Vps13c	UTSW	9	67972003	missense	probably damaging	1.00
R0811:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0812:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0839:Vps13c	UTSW	9	67898738	missense	probably benign
R1373:Vps13c	UTSW	9	67927511	missense	probably damaging	0.99
R1396:Vps13c	UTSW	9	67955022	missense	probably benign	0.00
R1499:Vps13c	UTSW	9	67957505	missense	probably benign	0.00
R1556:Vps13c	UTSW	9	67930711	missense	probably damaging	0.98
R1560:Vps13c	UTSW	9	67936463	critical splice donor site	probably null
R1584:Vps13c	UTSW	9	67893112	missense	possibly damaging	0.74
R1654:Vps13c	UTSW	9	67951687	missense	probably damaging	1.00
R1674:Vps13c	UTSW	9	67853703	nonsense	probably null
R1676:Vps13c	UTSW	9	67926962	missense	probably benign	0.20
R1695:Vps13c	UTSW	9	67972075	nonsense	probably null
R1710:Vps13c	UTSW	9	67911529	missense	probably benign	0.00
R1769:Vps13c	UTSW	9	67965721	missense	probably benign	0.00
R1775:Vps13c	UTSW	9	67881447	missense	probably damaging	1.00
R1795:Vps13c	UTSW	9	67893985	nonsense	probably null
R1799:Vps13c	UTSW	9	67944117	missense	probably damaging	0.98
R1835:Vps13c	UTSW	9	67993013	missense	probably benign	0.08
R1848:Vps13c	UTSW	9	67936340	missense	probably benign
R1903:Vps13c	UTSW	9	67894052	missense	probably damaging	1.00
R1944:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1945:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1951:Vps13c	UTSW	9	67973759	critical splice donor site	probably null
R1993:Vps13c	UTSW	9	67975856	missense	probably damaging	1.00
R2023:Vps13c	UTSW	9	67936285	splice site	probably benign
R2059:Vps13c	UTSW	9	67860833	missense	probably damaging	1.00
R2086:Vps13c	UTSW	9	67950289	missense	probably benign	0.29
R2120:Vps13c	UTSW	9	67919334	missense	possibly damaging	0.92
R2249:Vps13c	UTSW	9	67988053	critical splice donor site	probably null
R2257:Vps13c	UTSW	9	67952946	missense	possibly damaging	0.87
R2258:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2259:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2260:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2265:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2266:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2269:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2278:Vps13c	UTSW	9	67939072	missense	probably benign
R2306:Vps13c	UTSW	9	67987993	missense	probably damaging	0.99
R2327:Vps13c	UTSW	9	67913820	missense	probably damaging	0.98
R2349:Vps13c	UTSW	9	67957526	missense	possibly damaging	0.89
R2483:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3031:Vps13c	UTSW	9	67923770	missense	probably benign	0.00
R3623:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3870:Vps13c	UTSW	9	67884726	missense	probably benign	0.00
R4173:Vps13c	UTSW	9	67936313	missense	probably benign	0.00
R4445:Vps13c	UTSW	9	67982495	splice site	probably null
R4491:Vps13c	UTSW	9	67910193	missense	probably benign
R4505:Vps13c	UTSW	9	67939034	missense	probably benign	0.02
R4574:Vps13c	UTSW	9	67951683	missense	probably damaging	1.00
R4691:Vps13c	UTSW	9	67952935	missense	possibly damaging	0.95
R4766:Vps13c	UTSW	9	67878224	splice site	probably null
R4771:Vps13c	UTSW	9	67929539	missense	probably benign
R4801:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4802:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4962:Vps13c	UTSW	9	67873891	missense	probably damaging	1.00
R4995:Vps13c	UTSW	9	67919321	missense	probably benign	0.00
R5010:Vps13c	UTSW	9	67916379	missense	probably benign	0.19
R5183:Vps13c	UTSW	9	67908052	missense	probably damaging	1.00
R5226:Vps13c	UTSW	9	67945553	missense	probably benign	0.17
R5297:Vps13c	UTSW	9	67878131	missense	probably damaging	1.00
R5456:Vps13c	UTSW	9	67927447	missense	possibly damaging	0.53
R5494:Vps13c	UTSW	9	67948146	missense	probably benign	0.00
R5521:Vps13c	UTSW	9	67951439	missense	probably benign	0.08
R5524:Vps13c	UTSW	9	67957556	missense	probably damaging	1.00
R5685:Vps13c	UTSW	9	67963173	missense	possibly damaging	0.64
R5731:Vps13c	UTSW	9	67895379	missense	probably damaging	1.00
R5812:Vps13c	UTSW	9	67982495	splice site	probably benign
R5867:Vps13c	UTSW	9	67982622	splice site	probably null
R5893:Vps13c	UTSW	9	67902839	critical splice acceptor site	probably null
R5902:Vps13c	UTSW	9	67934447	missense	probably benign	0.00
R5957:Vps13c	UTSW	9	67954971	missense	probably damaging	1.00
R6076:Vps13c	UTSW	9	67911602	missense	probably damaging	1.00
R6187:Vps13c	UTSW	9	67915657	missense	probably damaging	1.00
R6268:Vps13c	UTSW	9	67951449	missense	probably benign	0.10
R6547:Vps13c	UTSW	9	67973365	missense	probably damaging	1.00
R6716:Vps13c	UTSW	9	67951467	missense	probably benign	0.00
R6837:Vps13c	UTSW	9	67910222	missense	probably benign
R6919:Vps13c	UTSW	9	67927452	missense	probably damaging	0.97
R7039:Vps13c	UTSW	9	67937763	missense	probably damaging	1.00
R7058:Vps13c	UTSW	9	67923828	missense	probably benign	0.39
R7082:Vps13c	UTSW	9	67883453	missense	probably damaging	1.00
R7195:Vps13c	UTSW	9	67945825	missense	possibly damaging	0.95
R7244:Vps13c	UTSW	9	67889804	missense	probably benign	0.00
R7300:Vps13c	UTSW	9	67940544	missense	probably benign	0.20
R7314:Vps13c	UTSW	9	67943340	splice site	probably null
R7352:Vps13c	UTSW	9	67840446	missense	possibly damaging	0.94
R7368:Vps13c	UTSW	9	67914073	missense	probably benign	0.23
R7411:Vps13c	UTSW	9	67972001	missense	probably damaging	0.98
R7497:Vps13c	UTSW	9	67840479	missense	probably damaging	1.00
R7638:Vps13c	UTSW	9	67945509	missense	probably damaging	1.00
R7732:Vps13c	UTSW	9	67940516	missense	probably damaging	0.97
R7748:Vps13c	UTSW	9	67963089	missense	probably benign	0.03
R7779:Vps13c	UTSW	9	67881422	missense	probably damaging	1.00
R7788:Vps13c	UTSW	9	67940483	missense	probably benign	0.01
R7894:Vps13c	UTSW	9	67926983	missense	probably damaging	0.99
R8163:Vps13c	UTSW	9	67950438	missense	probably benign	0.08
R8165:Vps13c	UTSW	9	67858790	missense	probably benign	0.00
R8202:Vps13c	UTSW	9	67944046	missense	probably damaging	0.98
R8235:Vps13c	UTSW	9	67927396	missense	probably damaging	1.00
R8235:Vps13c	UTSW	9	67955781	missense	probably benign	0.01
R8253:Vps13c	UTSW	9	67943488	nonsense	probably null
R8261:Vps13c	UTSW	9	67954980	missense	probably damaging	1.00
R8348:Vps13c	UTSW	9	67879103	missense	possibly damaging	0.79
R8547:Vps13c	UTSW	9	67945566	missense	probably damaging	1.00
R8734:Vps13c	UTSW	9	67973403	missense	probably damaging	1.00
R8806:Vps13c	UTSW	9	67945828	missense	probably damaging	1.00
R8807:Vps13c	UTSW	9	67858840	missense	probably damaging	0.99
R8813:Vps13c	UTSW	9	67871284	missense	probably damaging	1.00
R8883:Vps13c	UTSW	9	67948197	missense	probably benign	0.10
R8885:Vps13c	UTSW	9	67943454	missense	probably benign
R8899:Vps13c	UTSW	9	67934501	missense	probably damaging	0.98
R8970:Vps13c	UTSW	9	67945521	missense	probably benign	0.11
R9007:Vps13c	UTSW	9	67937724	missense	probably benign	0.00
R9026:Vps13c	UTSW	9	67954581	missense	probably damaging	1.00
R9029:Vps13c	UTSW	9	67948147	missense	probably damaging	0.98
R9057:Vps13c	UTSW	9	67920927	missense	probably benign	0.00
R9105:Vps13c	UTSW	9	67870799	intron	probably benign
R9130:Vps13c	UTSW	9	67929523	missense	probably damaging	1.00
R9286:Vps13c	UTSW	9	67972921	missense	probably benign	0.00
R9338:Vps13c	UTSW	9	67951695	missense	probably damaging	1.00
R9432:Vps13c	UTSW	9	67922855	missense	probably benign	0.02
R9460:Vps13c	UTSW	9	67930622	missense	possibly damaging	0.79
R9464:Vps13c	UTSW	9	67951392	missense	probably damaging	1.00
R9561:Vps13c	UTSW	9	67965512	missense	probably damaging	1.00
R9609:Vps13c	UTSW	9	67934549	missense	probably damaging	1.00
R9622:Vps13c	UTSW	9	67949433	missense	probably damaging	1.00
U24488:Vps13c	UTSW	9	67905916	missense	probably benign	0.13
X0021:Vps13c	UTSW	9	67937781	missense	probably damaging	0.99
X0058:Vps13c	UTSW	9	67927419	missense	probably damaging	1.00
X0065:Vps13c	UTSW	9	67873863	missense	probably damaging	1.00
Z1088:Vps13c	UTSW	9	67913975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGGACGTGTTTGTAAAGCTG -3'
(R):5'- GGGTCACTGCCATTACCAAGTG -3'

Sequencing Primer
(F):5'- GACGTGTTTGTAAAGCTGATTGAAC -3'
(R):5'- CTATGTCAAAACTTGCCAGTGC -3'

Posted On

2019-10-17