Incidental Mutation 'R7516:Alkbh5'
ID582478
Institutional Source Beutler Lab
Gene Symbol Alkbh5
Ensembl Gene ENSMUSG00000042650
Gene NamealkB homolog 5, RNA demethylase
SynonymsAbh5, Ofoxd
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R7516 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location60536381-60558512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60539153 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 244 (V244A)
Ref Sequence ENSEMBL: ENSMUSP00000049116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044250]
Predicted Effect probably damaging
Transcript: ENSMUST00000044250
AA Change: V244A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049116
Gene: ENSMUSG00000042650
AA Change: V244A

DomainStartEndE-ValueType
SCOP:d1gkub1 25 68 7e-5 SMART
Pfam:2OG-FeII_Oxy_2 94 313 1.7e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility associated with oligo- and teratozoopermia and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam28 T A 14: 68,630,676 I407F probably damaging Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Arap1 T C 7: 101,409,331 F1390L probably benign Het
Asph T C 4: 9,630,940 D136G possibly damaging Het
Atp8a2 A T 14: 59,857,067 Y841N probably damaging Het
Cald1 A T 6: 34,709,557 probably benign Het
Capn11 A G 17: 45,638,840 I400T possibly damaging Het
Cdh18 T A 15: 23,259,598 probably null Het
Ces2h T A 8: 105,016,826 L204Q probably damaging Het
Chrna3 G A 9: 55,015,369 A385V probably benign Het
Clca4a A T 3: 144,966,248 L311Q probably damaging Het
Clip1 A G 5: 123,583,385 V1149A probably benign Het
Clip3 T A 7: 30,298,843 V238D possibly damaging Het
Col12a1 A G 9: 79,612,910 probably null Het
Coro2a A G 4: 46,562,992 V54A probably benign Het
Crem T C 18: 3,299,141 probably null Het
Dennd5b T C 6: 149,068,380 I192V probably benign Het
Dst A G 1: 34,170,479 N1209S probably benign Het
Ero1l T A 14: 45,288,023 M385L probably benign Het
Fam13a A T 6: 58,955,263 V375D probably damaging Het
Fgfbp3 T A 19: 36,918,924 Y98F possibly damaging Het
Frem3 T C 8: 80,612,083 V335A probably damaging Het
Gm19410 T A 8: 35,796,279 D951E probably benign Het
Gpatch1 T C 7: 35,308,200 D145G probably benign Het
H60c G T 10: 3,259,746 C180* probably null Het
Hmcn1 T C 1: 150,622,967 T4054A probably benign Het
Hrg A G 16: 22,961,298 Y442C unknown Het
Hspg2 C T 4: 137,542,620 R2327C possibly damaging Het
Klhl31 G T 9: 77,651,147 A382S probably damaging Het
Knl1 T C 2: 119,070,698 V960A probably damaging Het
Lztr1 C T 16: 17,509,661 A76V possibly damaging Het
Me3 G T 7: 89,847,975 E395* probably null Het
Morc2b G A 17: 33,137,461 H446Y probably benign Het
Mroh7 A T 4: 106,691,119 M1054K probably benign Het
Ms4a6b T C 19: 11,529,543 V232A probably benign Het
Nmt2 C A 2: 3,312,730 D224E probably damaging Het
Nox4 C A 7: 87,321,697 R261S probably benign Het
Obscn T A 11: 59,124,590 K1019* probably null Het
Olfr1058 C T 2: 86,385,984 V145I probably benign Het
Olfr1234 T A 2: 89,363,375 N18I probably benign Het
Olfr1288 T A 2: 111,478,937 V51D probably benign Het
Olfr492 G A 7: 108,323,016 S220F probably damaging Het
Pcdha11 A T 18: 37,011,618 N254I probably damaging Het
Pck2 T A 14: 55,542,456 I54N probably benign Het
Pkd1l3 T A 8: 109,635,229 W978R probably damaging Het
Plxna4 T C 6: 32,237,768 T593A probably benign Het
Podn G A 4: 108,022,124 R266W probably damaging Het
Ptpn22 A G 3: 103,885,538 D335G probably benign Het
Pxn A G 5: 115,506,863 D3G unknown Het
Rapgefl1 T G 11: 98,846,134 V320G probably benign Het
Rel A G 11: 23,742,785 I416T probably benign Het
Sema5b A G 16: 35,651,170 N378D probably benign Het
Sh3bp4 C A 1: 89,145,646 L739M probably damaging Het
Skint2 A T 4: 112,625,971 D191V probably damaging Het
Slc3a1 T C 17: 85,063,762 Y581H probably damaging Het
Smcr8 G T 11: 60,779,988 C654F probably benign Het
Spta1 A C 1: 174,197,783 Q738P probably damaging Het
Sptlc3 C A 2: 139,589,518 A320D probably benign Het
Thnsl2 T A 6: 71,132,006 K274* probably null Het
Tmed2 T A 5: 124,546,992 I68K possibly damaging Het
Tmtc4 G A 14: 122,943,323 A326V possibly damaging Het
Tnks2 T A 19: 36,871,664 S179T possibly damaging Het
Trim34b G T 7: 104,329,711 C55F probably damaging Het
Trpm4 T A 7: 45,305,020 E1129V probably damaging Het
Tvp23b T C 11: 62,892,041 S188P possibly damaging Het
Usp1 A G 4: 98,934,119 T557A probably damaging Het
Vmn2r66 C T 7: 85,011,968 C18Y possibly damaging Het
Vmn2r85 T A 10: 130,418,983 T611S probably damaging Het
Vps13c T C 9: 67,955,007 S2969P possibly damaging Het
Wdr74 T A 19: 8,736,190 C62* probably null Het
Wfikkn1 A T 17: 25,878,046 C435S probably damaging Het
Zbtb45 A T 7: 13,006,342 F449I probably damaging Het
Other mutations in Alkbh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0346:Alkbh5 UTSW 11 60538741 missense possibly damaging 0.50
R1464:Alkbh5 UTSW 11 60539047 missense probably benign 0.38
R1464:Alkbh5 UTSW 11 60539047 missense probably benign 0.38
R2020:Alkbh5 UTSW 11 60538549 missense probably benign 0.03
R4824:Alkbh5 UTSW 11 60553871 critical splice donor site probably null
R5367:Alkbh5 UTSW 11 60538703 missense possibly damaging 0.58
R5979:Alkbh5 UTSW 11 60538691 missense probably damaging 1.00
R6132:Alkbh5 UTSW 11 60537995 start gained probably benign
R6902:Alkbh5 UTSW 11 60538555 missense probably benign 0.03
R7554:Alkbh5 UTSW 11 60538589 missense probably benign 0.00
R7758:Alkbh5 UTSW 11 60539077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACAGCGCGGTCATCAAC -3'
(R):5'- ATGGCCACTTCAAACCTGC -3'

Sequencing Primer
(F):5'- GCGCGGTCATCAACGACTAC -3'
(R):5'- GAGTTTCAGACACAAGCTTCCTATGG -3'
Posted On2019-10-17