Incidental Mutation 'R7517:Il1f8'
ID582501
Institutional Source Beutler Lab
Gene Symbol Il1f8
Ensembl Gene ENSMUSG00000026985
Gene Nameinterleukin 1 family, member 8
Synonyms2310043N20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24153161-24160519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24159878 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 167 (H167R)
Ref Sequence ENSEMBL: ENSMUSP00000028363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028363]
Predicted Effect probably benign
Transcript: ENSMUST00000028363
AA Change: H167R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028363
Gene: ENSMUSG00000026985
AA Change: H167R

DomainStartEndE-ValueType
IL1 33 180 3.19e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Il1f8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Il1f8 APN 2 24159913 missense probably benign 0.00
IGL01944:Il1f8 APN 2 24155279 missense probably damaging 1.00
IGL02379:Il1f8 APN 2 24154638 missense probably benign 0.01
R0035:Il1f8 UTSW 2 24159878 missense probably benign 0.19
R0035:Il1f8 UTSW 2 24159878 missense probably benign 0.19
R2137:Il1f8 UTSW 2 24154660 missense probably benign 0.00
R2139:Il1f8 UTSW 2 24154660 missense probably benign 0.00
R4052:Il1f8 UTSW 2 24159832 missense probably damaging 1.00
R4096:Il1f8 UTSW 2 24158814 missense possibly damaging 0.66
R4705:Il1f8 UTSW 2 24154618 missense probably benign 0.00
R5785:Il1f8 UTSW 2 24154649 missense probably benign 0.00
R6541:Il1f8 UTSW 2 24159815 missense probably damaging 1.00
R7752:Il1f8 UTSW 2 24158814 missense possibly damaging 0.66
R7858:Il1f8 UTSW 2 24154614 missense probably benign 0.00
R8252:Il1f8 UTSW 2 24158813 missense possibly damaging 0.46
R8820:Il1f8 UTSW 2 24159880 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCACCCGCTGCTAAGTTG -3'
(R):5'- CTGGTGAAGACATGGCATGG -3'

Sequencing Primer
(F):5'- ACCCGCTGCTAAGTTGCTGTAG -3'
(R):5'- AAGACATGGCATGGTGGTCTTC -3'
Posted On2019-10-17