Mutagenetix > Incidental Mutations

Incidental Mutation 'R7517:Tgm3'

582507

Institutional Source

Beutler Lab

Gene Symbol

Tgm3

Ensembl Gene

ENSMUSG00000027401

Gene Name

transglutaminase 3, E polypeptide

Synonyms

TG E

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7517 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130012349-130050399 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 130041764 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 447 (S447R)

Ref Sequence

ENSEMBL: ENSMUSP00000105928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110299]

Predicted Effect

probably benign
Transcript: ENSMUST00000110299
AA Change: S447R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: S447R

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	5	118	8.3e-33	PFAM
TGc	265	357	6.4e-39	SMART
Pfam:Transglut_C	483	588	3.9e-26	PFAM
Pfam:Transglut_C	595	693	4.9e-24	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	A	T	14: 31,715,374	V578E	possibly damaging	Het
Arhgap35	A	T	7: 16,562,207	C978S	probably benign	Het
Asph	A	T	4: 9,517,697	V475E	probably damaging	Het
Atf7ip2	T	A	16: 10,241,535		probably null	Het
Bace1	A	T	9: 45,860,261	D491V	probably benign	Het
Birc2	A	G	9: 7,819,423	I496T	probably benign	Het
Cacna2d4	C	T	6: 119,271,921	R448C	probably benign	Het
Ccdc181	T	C	1: 164,280,420	F224S	probably damaging	Het
Cdan1	C	T	2: 120,727,924	R469Q	probably damaging	Het
Ddx21	G	A	10: 62,588,790	P544L	probably damaging	Het
Epas1	C	A	17: 86,831,098	T874N	possibly damaging	Het
Fam13b	A	T	18: 34,494,607	D180E	probably damaging	Het
Fcgbp	G	A	7: 28,085,369	V285M	probably damaging	Het
Gcn1l1	T	G	5: 115,619,696	L2487V	probably benign	Het
Gm19410	C	T	8: 35,773,618	A216V	possibly damaging	Het
Gm4871	G	T	5: 145,032,620	R30S	probably damaging	Het
Gtf2ird1	T	C	5: 134,362,525	D899G	probably benign	Het
Hipk3	T	C	2: 104,434,714	T674A	probably benign	Het
Hnrnph3	A	G	10: 63,018,895	L39S	unknown	Het
Ift122	T	C	6: 115,890,582	V431A	probably benign	Het
Il1f8	A	G	2: 24,159,878	H167R	probably benign	Het
Lce3e	T	A	3: 92,967,835	C33S	unknown	Het
Lrrc26	T	C	2: 25,290,533	I182T	probably benign	Het
Magi1	T	C	6: 93,708,208	R730G	probably damaging	Het
Meis3	G	T	7: 16,177,818	V102F	probably damaging	Het
Mpp7	G	A	18: 7,440,183	Q263*	probably null	Het
Myo7b	A	T	18: 32,013,267	I155N	probably damaging	Het
Nrip1	A	T	16: 76,291,184	*1162K	probably null	Het
Olfr1104	A	C	2: 87,022,142	V134G	probably benign	Het
Olfr1300-ps1	T	C	2: 111,692,099	F194L	unknown	Het
Olfr401	T	A	11: 74,121,509	D73E	probably damaging	Het
Pdik1l	T	A	4: 134,278,425	E326V	possibly damaging	Het
Phrf1	T	C	7: 141,256,610	M265T	unknown	Het
Piezo2	A	T	18: 63,082,925	N1222K	possibly damaging	Het
Pkd1	G	A	17: 24,580,419	V2871M	probably damaging	Het
Pon2	T	G	6: 5,268,997	N226H	possibly damaging	Het
Rftn2	G	T	1: 55,195,549	D338E	probably damaging	Het
Rnf123	A	T	9: 108,070,274	Y171*	probably null	Het
Ror2	A	T	13: 53,110,865	N730K	possibly damaging	Het
Serpinb6c	T	A	13: 33,895,295	N138I	probably damaging	Het
Smco1	A	T	16: 32,273,967	H152L	possibly damaging	Het
Topbp1	A	G	9: 103,332,733	K860E	possibly damaging	Het
Uba7	C	A	9: 107,976,698		probably benign	Het
Ucp3	A	G	7: 100,481,882	N181D	probably damaging	Het
Unc13b	C	A	4: 43,215,765	S21R	probably benign	Het
Usp34	T	A	11: 23,446,968	S2395R		Het

Other mutations in Tgm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Tgm3	APN	2	130038413	missense	probably damaging	1.00
IGL00924:Tgm3	APN	2	130038374	missense	probably damaging	1.00
IGL01469:Tgm3	APN	2	130024494	missense	probably damaging	1.00
IGL01722:Tgm3	APN	2	130044568	missense	probably damaging	0.99
IGL01787:Tgm3	APN	2	130047740	missense	possibly damaging	0.85
IGL02269:Tgm3	APN	2	130024518	missense	probably benign	0.02
IGL02437:Tgm3	APN	2	130030041	splice site	probably null
IGL02449:Tgm3	APN	2	130038609	critical splice donor site	probably null
IGL02992:Tgm3	APN	2	130041979	missense	probably damaging	1.00
tortellini	UTSW	2	130024585	critical splice donor site	probably benign
ANU74:Tgm3	UTSW	2	130048390	missense	probably damaging	1.00
R0523:Tgm3	UTSW	2	130044662	critical splice donor site	probably null
R0833:Tgm3	UTSW	2	130026682	splice site	probably benign
R0834:Tgm3	UTSW	2	130026757	missense	probably benign	0.00
R0836:Tgm3	UTSW	2	130026682	splice site	probably benign
R0940:Tgm3	UTSW	2	130012406	missense	probably benign	0.00
R1354:Tgm3	UTSW	2	130041898	missense	probably benign
R1642:Tgm3	UTSW	2	130047782	missense	probably damaging	1.00
R1670:Tgm3	UTSW	2	130041768	nonsense	probably null
R1715:Tgm3	UTSW	2	130026814	critical splice donor site	probably null
R1944:Tgm3	UTSW	2	130029969	missense	probably damaging	0.99
R2104:Tgm3	UTSW	2	130037483	missense	probably benign	0.39
R3416:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R3417:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R4231:Tgm3	UTSW	2	130044589	nonsense	probably null
R4296:Tgm3	UTSW	2	130038413	missense	possibly damaging	0.77
R4794:Tgm3	UTSW	2	130041955	missense	probably benign	0.00
R4948:Tgm3	UTSW	2	130048320	missense	probably benign	0.00
R5034:Tgm3	UTSW	2	130037484	missense	possibly damaging	0.95
R5144:Tgm3	UTSW	2	130048282	missense	possibly damaging	0.95
R5786:Tgm3	UTSW	2	130026784	nonsense	probably null
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6182:Tgm3	UTSW	2	130025301	nonsense	probably null
R6219:Tgm3	UTSW	2	130038610	critical splice donor site	probably null
R6901:Tgm3	UTSW	2	130041970	missense	possibly damaging	0.95
R6969:Tgm3	UTSW	2	130042029	missense	probably benign	0.06
R6980:Tgm3	UTSW	2	130026777	missense	probably benign	0.17
R7282:Tgm3	UTSW	2	130024561	missense	probably benign	0.00
R7317:Tgm3	UTSW	2	130048291	missense	probably benign	0.09
R7513:Tgm3	UTSW	2	130024404	missense	probably benign	0.00
R7793:Tgm3	UTSW	2	130012410	critical splice donor site	probably null
R7822:Tgm3	UTSW	2	130041899	missense	probably benign	0.00
R7955:Tgm3	UTSW	2	130038480	missense	probably benign
R8747:Tgm3	UTSW	2	130044532	missense	probably benign	0.03
R8805:Tgm3	UTSW	2	130047782	missense	probably damaging	1.00
X0065:Tgm3	UTSW	2	130024510	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GGAGACCTGACAAGATTAGACCC -3'
(R):5'- AGGCTGTCATGTTCATCGTCAC -3'

Sequencing Primer
(F):5'- CTGACAAGATTAGACCCTTGCTGG -3'
(R):5'- CATGTTTTTGAGCATCAGGGACAGAC -3'

Posted On

2019-10-17