Incidental Mutation 'R7517:Lce3e'
ID 582508
Institutional Source Beutler Lab
Gene Symbol Lce3e
Ensembl Gene ENSMUSG00000074433
Gene Name late cornified envelope 3E
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 92967061-92968281 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 92967835 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 33 (C33S)
Ref Sequence ENSEMBL: ENSMUSP00000096484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098886]
AlphaFold F8VQJ0
Predicted Effect unknown
Transcript: ENSMUST00000098886
AA Change: C33S
SMART Domains Protein: ENSMUSP00000096484
Gene: ENSMUSG00000074433
AA Change: C33S

DomainStartEndE-ValueType
Pfam:LCE 2 98 2.5e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Lce3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3853:Lce3e UTSW 3 92967832 nonsense probably null
R6355:Lce3e UTSW 3 92967735 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGCATTTGACAGACTAAGTC -3'
(R):5'- CGGGCTGAATTTTCCTTGGC -3'

Sequencing Primer
(F):5'- GCATTTGACAGACTAAGTCAGTAGAC -3'
(R):5'- ATCCAGGTCAGCAGCAGC -3'
Posted On 2019-10-17