Mutagenetix > Incidental Mutation

Incidental Mutation 'R7517:Unc13b'

582510

Institutional Source

Beutler Lab

Gene Symbol

Unc13b

Ensembl Gene

ENSMUSG00000028456

Gene Name

unc-13 homolog B (C. elegans)

Synonyms

Unc13h2, Munc13-2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R7517 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43058953-43264871 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 43215765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 21 (S21R)

Ref Sequence

ENSEMBL: ENSMUSP00000146589 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]

AlphaFold

Q9Z1N9

Predicted Effect

probably benign
Transcript: ENSMUST00000079978

SMART Domains

Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1262	1404	4.8e-60	PFAM
C2	1438	1544	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107952

SMART Domains

Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1033	2.02e-53	SMART
Pfam:Membr_traf_MHD	1274	1416	4.8e-60	PFAM
C2	1450	1556	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107953

SMART Domains

Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1263	1403	2.3e-56	PFAM
C2	1457	1563	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163653

SMART Domains

Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1032	4.64e-53	SMART
Pfam:Membr_traf_MHD	1273	1415	4.8e-60	PFAM
C2	1449	1555	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168032

SMART Domains

Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C1	147	196	4.21e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207569

Predicted Effect

probably benign
Transcript: ENSMUST00000207708
AA Change: S21R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	A	T	14: 31,715,374	V578E	possibly damaging	Het
Arhgap35	A	T	7: 16,562,207	C978S	probably benign	Het
Asph	A	T	4: 9,517,697	V475E	probably damaging	Het
Atf7ip2	T	A	16: 10,241,535		probably null	Het
Bace1	A	T	9: 45,860,261	D491V	probably benign	Het
Birc2	A	G	9: 7,819,423	I496T	probably benign	Het
Cacna2d4	C	T	6: 119,271,921	R448C	probably benign	Het
Ccdc181	T	C	1: 164,280,420	F224S	probably damaging	Het
Cdan1	C	T	2: 120,727,924	R469Q	probably damaging	Het
Ddx21	G	A	10: 62,588,790	P544L	probably damaging	Het
Epas1	C	A	17: 86,831,098	T874N	possibly damaging	Het
Fam13b	A	T	18: 34,494,607	D180E	probably damaging	Het
Fcgbp	G	A	7: 28,085,369	V285M	probably damaging	Het
Gcn1l1	T	G	5: 115,619,696	L2487V	probably benign	Het
Gm19410	C	T	8: 35,773,618	A216V	possibly damaging	Het
Gm4871	G	T	5: 145,032,620	R30S	probably damaging	Het
Gtf2ird1	T	C	5: 134,362,525	D899G	probably benign	Het
Hipk3	T	C	2: 104,434,714	T674A	probably benign	Het
Hnrnph3	A	G	10: 63,018,895	L39S	unknown	Het
Ift122	T	C	6: 115,890,582	V431A	probably benign	Het
Il1f8	A	G	2: 24,159,878	H167R	probably benign	Het
Lce3e	T	A	3: 92,967,835	C33S	unknown	Het
Lrrc26	T	C	2: 25,290,533	I182T	probably benign	Het
Magi1	T	C	6: 93,708,208	R730G	probably damaging	Het
Meis3	G	T	7: 16,177,818	V102F	probably damaging	Het
Mpp7	G	A	18: 7,440,183	Q263*	probably null	Het
Myo7b	A	T	18: 32,013,267	I155N	probably damaging	Het
Nrip1	A	T	16: 76,291,184	*1162K	probably null	Het
Olfr1104	A	C	2: 87,022,142	V134G	probably benign	Het
Olfr1300-ps1	T	C	2: 111,692,099	F194L	unknown	Het
Olfr401	T	A	11: 74,121,509	D73E	probably damaging	Het
Pdik1l	T	A	4: 134,278,425	E326V	possibly damaging	Het
Phrf1	T	C	7: 141,256,610	M265T	unknown	Het
Piezo2	A	T	18: 63,082,925	N1222K	possibly damaging	Het
Pkd1	G	A	17: 24,580,419	V2871M	probably damaging	Het
Pon2	T	G	6: 5,268,997	N226H	possibly damaging	Het
Rftn2	G	T	1: 55,195,549	D338E	probably damaging	Het
Rnf123	A	T	9: 108,070,274	Y171*	probably null	Het
Ror2	A	T	13: 53,110,865	N730K	possibly damaging	Het
Serpinb6c	T	A	13: 33,895,295	N138I	probably damaging	Het
Smco1	A	T	16: 32,273,967	H152L	possibly damaging	Het
Tgm3	T	G	2: 130,041,764	S447R	probably benign	Het
Topbp1	A	G	9: 103,332,733	K860E	possibly damaging	Het
Uba7	C	A	9: 107,976,698		probably benign	Het
Ucp3	A	G	7: 100,481,882	N181D	probably damaging	Het
Usp34	T	A	11: 23,446,968	S2395R		Het

Other mutations in Unc13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Unc13b	APN	4	43240285	missense	probably damaging	1.00
IGL00832:Unc13b	APN	4	43258921	missense	probably damaging	1.00
IGL01111:Unc13b	APN	4	43096927	missense	possibly damaging	0.76
IGL01115:Unc13b	APN	4	43258492	missense	probably damaging	1.00
IGL01137:Unc13b	APN	4	43091291	missense	probably damaging	1.00
IGL01637:Unc13b	APN	4	43241066	missense	probably damaging	1.00
IGL01789:Unc13b	APN	4	43239462	missense	probably damaging	1.00
IGL01792:Unc13b	APN	4	43250218	missense	probably damaging	0.99
IGL01877:Unc13b	APN	4	43249583	critical splice donor site	probably null
IGL01924:Unc13b	APN	4	43239385	nonsense	probably null
IGL02087:Unc13b	APN	4	43091270	missense	probably null	1.00
IGL02197:Unc13b	APN	4	43165828	missense	probably damaging	0.99
IGL02504:Unc13b	APN	4	43263031	missense	probably damaging	1.00
IGL02659:Unc13b	APN	4	43235332	missense	probably damaging	1.00
IGL03031:Unc13b	APN	4	43235368	missense	probably damaging	1.00
IGL03036:Unc13b	APN	4	43235249	missense	probably damaging	1.00
IGL03209:Unc13b	APN	4	43239351	missense	probably damaging	0.99
IGL03352:Unc13b	APN	4	43237110	missense	possibly damaging	0.90
BB006:Unc13b	UTSW	4	43174399	missense	unknown
BB016:Unc13b	UTSW	4	43174399	missense	unknown
G1Funyon:Unc13b	UTSW	4	43263568	missense	probably benign
P0028:Unc13b	UTSW	4	43256225	missense	probably damaging	1.00
PIT4585001:Unc13b	UTSW	4	43091298	missense	probably benign	0.03
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0335:Unc13b	UTSW	4	43236983	missense	possibly damaging	0.95
R0504:Unc13b	UTSW	4	43263559	missense	probably damaging	0.99
R0631:Unc13b	UTSW	4	43182849	missense	possibly damaging	0.47
R0748:Unc13b	UTSW	4	43241164	splice site	probably benign
R1275:Unc13b	UTSW	4	43235366	missense	probably damaging	1.00
R1293:Unc13b	UTSW	4	43235190	missense	probably damaging	1.00
R1434:Unc13b	UTSW	4	43239385	nonsense	probably null
R1552:Unc13b	UTSW	4	43237144	missense	probably damaging	0.99
R1591:Unc13b	UTSW	4	43244747	missense	probably damaging	1.00
R1628:Unc13b	UTSW	4	43263371	missense	probably damaging	1.00
R1740:Unc13b	UTSW	4	43240285	missense	probably damaging	1.00
R1839:Unc13b	UTSW	4	43258308	splice site	probably benign
R2045:Unc13b	UTSW	4	43091266	missense	probably damaging	1.00
R2191:Unc13b	UTSW	4	43245566	nonsense	probably null
R2259:Unc13b	UTSW	4	43182780	missense	possibly damaging	0.87
R2307:Unc13b	UTSW	4	43239854	missense	probably damaging	0.98
R2317:Unc13b	UTSW	4	43245514	missense	probably damaging	1.00
R2402:Unc13b	UTSW	4	43095843	missense	probably benign
R2847:Unc13b	UTSW	4	43180404	missense	probably benign	0.04
R3414:Unc13b	UTSW	4	43234658	splice site	probably benign
R3436:Unc13b	UTSW	4	43097028	splice site	probably benign
R3955:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R3957:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R4015:Unc13b	UTSW	4	43237801	missense	probably damaging	1.00
R4650:Unc13b	UTSW	4	43261035	missense	probably damaging	0.97
R4836:Unc13b	UTSW	4	43237137	missense	probably damaging	1.00
R5041:Unc13b	UTSW	4	43237836	missense	probably benign	0.41
R5413:Unc13b	UTSW	4	43257936	critical splice donor site	probably null
R5994:Unc13b	UTSW	4	43172596	intron	probably benign
R6015:Unc13b	UTSW	4	43177995	nonsense	probably null
R6090:Unc13b	UTSW	4	43239306	missense	probably damaging	1.00
R6242:Unc13b	UTSW	4	43165800	missense	possibly damaging	0.92
R6246:Unc13b	UTSW	4	43216246	missense	probably benign	0.18
R6427:Unc13b	UTSW	4	43176966	unclassified	probably benign
R6660:Unc13b	UTSW	4	43177412	unclassified	probably benign
R6670:Unc13b	UTSW	4	43255562	missense	probably damaging	0.99
R6753:Unc13b	UTSW	4	43239331	missense	probably damaging	1.00
R6858:Unc13b	UTSW	4	43165828	missense	possibly damaging	0.85
R6886:Unc13b	UTSW	4	43170156	intron	probably benign
R6969:Unc13b	UTSW	4	43263538	missense	possibly damaging	0.94
R6994:Unc13b	UTSW	4	43171403	intron	probably benign
R6994:Unc13b	UTSW	4	43173203	intron	probably benign
R7080:Unc13b	UTSW	4	43171926	missense	unknown
R7117:Unc13b	UTSW	4	43216544	missense	probably benign	0.33
R7132:Unc13b	UTSW	4	43215757	missense	probably benign	0.17
R7181:Unc13b	UTSW	4	43258893	missense	probably damaging	0.99
R7192:Unc13b	UTSW	4	43258519	missense	probably damaging	1.00
R7246:Unc13b	UTSW	4	43172910	missense	unknown
R7342:Unc13b	UTSW	4	43258703	missense	probably damaging	0.99
R7345:Unc13b	UTSW	4	43173966	missense	unknown
R7355:Unc13b	UTSW	4	43237754	missense	probably damaging	1.00
R7391:Unc13b	UTSW	4	43216459	missense	probably benign	0.03
R7419:Unc13b	UTSW	4	43174023	missense	unknown
R7424:Unc13b	UTSW	4	43172235	missense	unknown
R7532:Unc13b	UTSW	4	43249565	missense	probably benign	0.44
R7564:Unc13b	UTSW	4	43091258	missense	probably damaging	1.00
R7598:Unc13b	UTSW	4	43263569	missense	probably benign	0.20
R7604:Unc13b	UTSW	4	43170102	missense	unknown
R7604:Unc13b	UTSW	4	43256776	missense	possibly damaging	0.95
R7643:Unc13b	UTSW	4	43216333	missense	probably benign
R7718:Unc13b	UTSW	4	43173854	missense	unknown
R7735:Unc13b	UTSW	4	43165791	missense	probably damaging	1.00
R7756:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177330	small insertion	probably benign
R7757:Unc13b	UTSW	4	43177341	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177312	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177344	small insertion	probably benign
R7781:Unc13b	UTSW	4	43259546	missense	possibly damaging	0.87
R7793:Unc13b	UTSW	4	43172737	missense	unknown
R7858:Unc13b	UTSW	4	43176285	missense	unknown
R7867:Unc13b	UTSW	4	43232573	nonsense	probably null
R7897:Unc13b	UTSW	4	43171860	missense	unknown
R7904:Unc13b	UTSW	4	43217075	missense	probably benign
R7929:Unc13b	UTSW	4	43174399	missense	unknown
R7984:Unc13b	UTSW	4	43173973	missense	unknown
R8069:Unc13b	UTSW	4	43177597	missense	unknown
R8101:Unc13b	UTSW	4	43239918	missense	probably benign	0.08
R8246:Unc13b	UTSW	4	43175954	missense	unknown
R8289:Unc13b	UTSW	4	43172524	nonsense	probably null
R8301:Unc13b	UTSW	4	43263568	missense	probably benign
R8397:Unc13b	UTSW	4	43217290	missense	probably benign	0.12
R8421:Unc13b	UTSW	4	43178304	missense	unknown
R8738:Unc13b	UTSW	4	43177564	missense	unknown
R8746:Unc13b	UTSW	4	43176120	missense	unknown
R8766:Unc13b	UTSW	4	43174722	missense	unknown
R8825:Unc13b	UTSW	4	43237683	splice site	probably benign
R8834:Unc13b	UTSW	4	43175954	missense	unknown
R8862:Unc13b	UTSW	4	43235207	missense	probably damaging	1.00
R8864:Unc13b	UTSW	4	43174724	missense	unknown
R8889:Unc13b	UTSW	4	43176484	missense	unknown
R8892:Unc13b	UTSW	4	43176484	missense	unknown
R8904:Unc13b	UTSW	4	43178531	intron	probably benign
R9089:Unc13b	UTSW	4	43095847	missense	probably damaging	1.00
R9144:Unc13b	UTSW	4	43173649	missense	unknown
R9149:Unc13b	UTSW	4	43176186	missense	unknown
R9173:Unc13b	UTSW	4	43177421	missense	unknown
R9200:Unc13b	UTSW	4	43257352	missense	possibly damaging	0.50
R9232:Unc13b	UTSW	4	43240321	missense	probably benign	0.03
R9269:Unc13b	UTSW	4	43171955	missense	unknown
R9320:Unc13b	UTSW	4	43171044	missense	unknown
R9335:Unc13b	UTSW	4	43216123	missense	possibly damaging	0.86
R9335:Unc13b	UTSW	4	43255551	missense	probably damaging	0.99
R9352:Unc13b	UTSW	4	43177312	small insertion	probably benign
R9352:Unc13b	UTSW	4	43177313	nonsense	probably null
R9378:Unc13b	UTSW	4	43173282	missense	unknown
R9382:Unc13b	UTSW	4	43172512	missense	unknown
R9569:Unc13b	UTSW	4	43177312	small deletion	probably benign
R9622:Unc13b	UTSW	4	43172513	missense
R9687:Unc13b	UTSW	4	43174920	missense	unknown
R9704:Unc13b	UTSW	4	43237102	missense	probably benign	0.31
R9721:Unc13b	UTSW	4	43101869	missense	probably benign
R9753:Unc13b	UTSW	4	43182842	nonsense	probably null
RF016:Unc13b	UTSW	4	43177347	small insertion	probably benign
RF016:Unc13b	UTSW	4	43177350	small insertion	probably benign
RF041:Unc13b	UTSW	4	43177338	small insertion	probably benign
RF056:Unc13b	UTSW	4	43177359	small insertion	probably benign
Z1176:Unc13b	UTSW	4	43171419	missense	unknown
Z1176:Unc13b	UTSW	4	43177191	missense	unknown
Z1176:Unc13b	UTSW	4	43177764	missense	unknown
Z1176:Unc13b	UTSW	4	43261043	missense	probably benign	0.11
Z1177:Unc13b	UTSW	4	43173669	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTGAGGCTTCAACTAGCAATAGTC -3'
(R):5'- TTGGCTTGCTGCTCAAAGC -3'

Sequencing Primer
(F):5'- TAGCAATAGTCGTTAAAAGCCAATCC -3'
(R):5'- TGCTGCTCAAAGCTACAAAGTTGG -3'

Posted On

2019-10-17