Mutagenetix > Incidental Mutation

Incidental Mutation 'R7517:Gtf2ird1'

582513

Institutional Source

Beutler Lab

Gene Symbol

Gtf2ird1

Ensembl Gene

ENSMUSG00000023079

Gene Name

general transcription factor II I repeat domain-containing 1

Synonyms

binding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.747) question?

Stock #

R7517 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134357656-134456716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134362525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 899 (D899G)

Ref Sequence

ENSEMBL: ENSMUSP00000098217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202104] [ENSMUST00000202165] [ENSMUST00000202280] [ENSMUST00000202321] [ENSMUST00000202554] [ENSMUST00000202829]

AlphaFold

Q9JI57

Predicted Effect

probably benign
Transcript: ENSMUST00000073161
AA Change: D899G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: D899G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	814	889	1.7e-34	PFAM
Pfam:GTF2I	917	992	1.7e-34	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000074114

SMART Domains

Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.5e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	2.8e-34	PFAM
Pfam:GTF2I	814	889	1.6e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100650
AA Change: D872G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: D872G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.2e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	787	862	1.8e-34	PFAM
Pfam:GTF2I	890	965	1.8e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100652
AA Change: D899G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: D899G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.8e-29	PFAM
Pfam:GTF2I	351	425	6.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.3e-34	PFAM
Pfam:GTF2I	690	764	3.3e-32	PFAM
Pfam:GTF2I	814	888	3e-33	PFAM
Pfam:GTF2I	917	991	3e-33	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100654
AA Change: D801G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: D801G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	716	791	1.5e-34	PFAM
Pfam:GTF2I	819	894	1.5e-34	PFAM
low complexity region	922	945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111244
AA Change: D872G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: D872G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.3e-29	PFAM
Pfam:GTF2I	351	425	4.9e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1.7e-34	PFAM
Pfam:GTF2I	690	764	2.5e-32	PFAM
Pfam:GTF2I	787	861	2.3e-33	PFAM
Pfam:GTF2I	890	964	2.3e-33	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111245
AA Change: D853G

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: D853G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.6e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	671	746	2.9e-34	PFAM
Pfam:GTF2I	768	843	1.7e-34	PFAM
Pfam:GTF2I	871	946	1.7e-34	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167084

SMART Domains

Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	690	765	2.7e-34	PFAM
Pfam:GTF2I	814	889	1.5e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171794
AA Change: D872G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: D872G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.2e-29	PFAM
Pfam:GTF2I	351	426	3.8e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	8.9e-35	PFAM
Pfam:GTF2I	690	765	2.4e-34	PFAM
Pfam:GTF2I	787	862	1.4e-34	PFAM
Pfam:GTF2I	890	965	1.4e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200944

SMART Domains

Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.9e-29	PFAM
Pfam:GTF2I	351	425	5.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2e-34	PFAM
Pfam:GTF2I	690	764	2.8e-32	PFAM
Pfam:GTF2I	814	888	2.6e-33	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201495

Predicted Effect

probably benign
Transcript: ENSMUST00000202104
AA Change: D40G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144203
Gene: ENSMUSG00000023079
AA Change: D40G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	1	29	7.9e-7	PFAM
Pfam:GTF2I	58	132	7.3e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202165

SMART Domains

Protein: ENSMUSP00000144420
Gene: ENSMUSG00000023079

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
Pfam:GTF2I	35	109	7.6e-33	PFAM
Pfam:GTF2I	167	193	4.2e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202280
AA Change: D872G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: D872G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	2.6e-26	PFAM
Pfam:GTF2I	351	425	2.9e-29	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1e-31	PFAM
Pfam:GTF2I	690	764	1.5e-29	PFAM
Pfam:GTF2I	787	861	1.3e-30	PFAM
low complexity region	890	913	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202321

Predicted Effect

probably benign
Transcript: ENSMUST00000202554
AA Change: D853G

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: D853G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.5e-29	PFAM
Pfam:GTF2I	351	425	6.3e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.2e-34	PFAM
Pfam:GTF2I	671	745	3.2e-32	PFAM
Pfam:GTF2I	768	842	2.9e-33	PFAM
Pfam:GTF2I	871	945	2.9e-33	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202829
AA Change: D172G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000144604
Gene: ENSMUSG00000023079
AA Change: D172G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	1	44	1.4e-15	PFAM
Pfam:GTF2I	87	161	4.6e-34	PFAM
Pfam:GTF2I	190	264	4.6e-34	PFAM
low complexity region	293	316	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	A	T	14: 31,715,374	V578E	possibly damaging	Het
Arhgap35	A	T	7: 16,562,207	C978S	probably benign	Het
Asph	A	T	4: 9,517,697	V475E	probably damaging	Het
Atf7ip2	T	A	16: 10,241,535		probably null	Het
Bace1	A	T	9: 45,860,261	D491V	probably benign	Het
Birc2	A	G	9: 7,819,423	I496T	probably benign	Het
Cacna2d4	C	T	6: 119,271,921	R448C	probably benign	Het
Ccdc181	T	C	1: 164,280,420	F224S	probably damaging	Het
Cdan1	C	T	2: 120,727,924	R469Q	probably damaging	Het
Ddx21	G	A	10: 62,588,790	P544L	probably damaging	Het
Epas1	C	A	17: 86,831,098	T874N	possibly damaging	Het
Fam13b	A	T	18: 34,494,607	D180E	probably damaging	Het
Fcgbp	G	A	7: 28,085,369	V285M	probably damaging	Het
Gcn1l1	T	G	5: 115,619,696	L2487V	probably benign	Het
Gm19410	C	T	8: 35,773,618	A216V	possibly damaging	Het
Gm4871	G	T	5: 145,032,620	R30S	probably damaging	Het
Hipk3	T	C	2: 104,434,714	T674A	probably benign	Het
Hnrnph3	A	G	10: 63,018,895	L39S	unknown	Het
Ift122	T	C	6: 115,890,582	V431A	probably benign	Het
Il1f8	A	G	2: 24,159,878	H167R	probably benign	Het
Lce3e	T	A	3: 92,967,835	C33S	unknown	Het
Lrrc26	T	C	2: 25,290,533	I182T	probably benign	Het
Magi1	T	C	6: 93,708,208	R730G	probably damaging	Het
Meis3	G	T	7: 16,177,818	V102F	probably damaging	Het
Mpp7	G	A	18: 7,440,183	Q263*	probably null	Het
Myo7b	A	T	18: 32,013,267	I155N	probably damaging	Het
Nrip1	A	T	16: 76,291,184	*1162K	probably null	Het
Olfr1104	A	C	2: 87,022,142	V134G	probably benign	Het
Olfr1300-ps1	T	C	2: 111,692,099	F194L	unknown	Het
Olfr401	T	A	11: 74,121,509	D73E	probably damaging	Het
Pdik1l	T	A	4: 134,278,425	E326V	possibly damaging	Het
Phrf1	T	C	7: 141,256,610	M265T	unknown	Het
Piezo2	A	T	18: 63,082,925	N1222K	possibly damaging	Het
Pkd1	G	A	17: 24,580,419	V2871M	probably damaging	Het
Pon2	T	G	6: 5,268,997	N226H	possibly damaging	Het
Rftn2	G	T	1: 55,195,549	D338E	probably damaging	Het
Rnf123	A	T	9: 108,070,274	Y171*	probably null	Het
Ror2	A	T	13: 53,110,865	N730K	possibly damaging	Het
Serpinb6c	T	A	13: 33,895,295	N138I	probably damaging	Het
Smco1	A	T	16: 32,273,967	H152L	possibly damaging	Het
Tgm3	T	G	2: 130,041,764	S447R	probably benign	Het
Topbp1	A	G	9: 103,332,733	K860E	possibly damaging	Het
Uba7	C	A	9: 107,976,698		probably benign	Het
Ucp3	A	G	7: 100,481,882	N181D	probably damaging	Het
Unc13b	C	A	4: 43,215,765	S21R	probably benign	Het
Usp34	T	A	11: 23,446,968	S2395R		Het

Other mutations in Gtf2ird1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Gtf2ird1	APN	5	134358891	missense	probably benign	0.03
IGL02477:Gtf2ird1	APN	5	134379978	missense	probably damaging	1.00
IGL02659:Gtf2ird1	APN	5	134377041	missense	probably damaging	1.00
IGL02752:Gtf2ird1	APN	5	134358824	makesense	probably null
IGL02963:Gtf2ird1	APN	5	134389687	missense	probably benign	0.05
IGL03328:Gtf2ird1	APN	5	134389129	critical splice donor site	probably null
IGL03379:Gtf2ird1	APN	5	134382538	missense	possibly damaging	0.94
R0585:Gtf2ird1	UTSW	5	134376942	missense	probably damaging	1.00
R1199:Gtf2ird1	UTSW	5	134411064	missense	possibly damaging	0.85
R1388:Gtf2ird1	UTSW	5	134395710	missense	probably damaging	1.00
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1544:Gtf2ird1	UTSW	5	134358918	missense	possibly damaging	0.93
R1652:Gtf2ird1	UTSW	5	134395713	missense	probably damaging	1.00
R1792:Gtf2ird1	UTSW	5	134366936	splice site	probably null
R1852:Gtf2ird1	UTSW	5	134382580	splice site	probably null
R1938:Gtf2ird1	UTSW	5	134415245	missense	probably damaging	1.00
R1996:Gtf2ird1	UTSW	5	134376886	splice site	probably benign
R2020:Gtf2ird1	UTSW	5	134417093	missense	probably damaging	1.00
R2025:Gtf2ird1	UTSW	5	134363934	missense	probably damaging	1.00
R2849:Gtf2ird1	UTSW	5	134359007	missense	probably damaging	1.00
R2964:Gtf2ird1	UTSW	5	134357684	splice site	probably null
R3421:Gtf2ird1	UTSW	5	134388500	missense	probably benign	0.41
R4543:Gtf2ird1	UTSW	5	134363900	critical splice donor site	probably null
R4569:Gtf2ird1	UTSW	5	134411003	missense	probably damaging	1.00
R4664:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4665:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4666:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4680:Gtf2ird1	UTSW	5	134357881	missense	probably damaging	1.00
R4709:Gtf2ird1	UTSW	5	134404734	missense	probably benign
R4806:Gtf2ird1	UTSW	5	134383896	missense	probably damaging	0.99
R4823:Gtf2ird1	UTSW	5	134395722	missense	probably damaging	1.00
R4857:Gtf2ird1	UTSW	5	134362544	missense	probably damaging	0.96
R4970:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R4974:Gtf2ird1	UTSW	5	134357831	nonsense	probably null
R4975:Gtf2ird1	UTSW	5	134395627	missense	probably damaging	1.00
R5072:Gtf2ird1	UTSW	5	134390933	splice site	probably null
R5112:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R5653:Gtf2ird1	UTSW	5	134410967	missense	probably damaging	1.00
R5681:Gtf2ird1	UTSW	5	134363318	missense	probably damaging	1.00
R5738:Gtf2ird1	UTSW	5	134383818	missense	probably damaging	1.00
R5753:Gtf2ird1	UTSW	5	134410983	missense	probably damaging	1.00
R6385:Gtf2ird1	UTSW	5	134404690	missense	probably benign	0.19
R6580:Gtf2ird1	UTSW	5	134361039	missense	probably damaging	1.00
R6787:Gtf2ird1	UTSW	5	134363912	missense	probably damaging	0.99
R6981:Gtf2ird1	UTSW	5	134383922	splice site	probably benign
R7208:Gtf2ird1	UTSW	5	134411094	missense	probably benign	0.35
R7271:Gtf2ird1	UTSW	5	134404904	missense	probably benign	0.01
R7786:Gtf2ird1	UTSW	5	134390899	nonsense	probably null
R7788:Gtf2ird1	UTSW	5	134417131	nonsense	probably null
R7850:Gtf2ird1	UTSW	5	134363215	missense	probably benign	0.21
R7866:Gtf2ird1	UTSW	5	134363209	missense	probably benign	0.01
R8183:Gtf2ird1	UTSW	5	134357835	missense	unknown
R8712:Gtf2ird1	UTSW	5	134415210	missense	probably damaging	1.00
R8844:Gtf2ird1	UTSW	5	134361025	nonsense	probably null
R9473:Gtf2ird1	UTSW	5	134404680	missense	probably benign	0.08
R9669:Gtf2ird1	UTSW	5	134379940	missense	probably damaging	0.99
R9737:Gtf2ird1	UTSW	5	134379940	missense	probably damaging	0.99
X0026:Gtf2ird1	UTSW	5	134376102	splice site	probably null
Z1176:Gtf2ird1	UTSW	5	134409312	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACGTACAGCTTAGCTCACTCTG -3'
(R):5'- CCTGAGTCAGAAGATCAACTCC -3'

Sequencing Primer
(F):5'- CAGCTTAGCTCACTCTGTTTTAAAGG -3'
(R):5'- GGAAGGATGTTTCCCATGACCTATC -3'

Posted On

2019-10-17