Incidental Mutation 'R7517:Gtf2ird1'
ID582513
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Namegeneral transcription factor II I repeat domain-containing 1
Synonymsbinding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location134357656-134456716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134362525 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 899 (D899G)
Ref Sequence ENSEMBL: ENSMUSP00000098217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202104] [ENSMUST00000202165] [ENSMUST00000202280] [ENSMUST00000202321] [ENSMUST00000202554] [ENSMUST00000202829]
Predicted Effect probably benign
Transcript: ENSMUST00000073161
AA Change: D899G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: D899G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074114
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100650
AA Change: D872G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: D872G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100652
AA Change: D899G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: D899G

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100654
AA Change: D801G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: D801G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111244
AA Change: D872G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: D872G

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111245
AA Change: D853G

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: D853G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167084
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171794
AA Change: D872G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: D872G

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200944
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201495
Predicted Effect probably benign
Transcript: ENSMUST00000202104
AA Change: D40G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144203
Gene: ENSMUSG00000023079
AA Change: D40G

DomainStartEndE-ValueType
Pfam:GTF2I 1 29 7.9e-7 PFAM
Pfam:GTF2I 58 132 7.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202165
SMART Domains Protein: ENSMUSP00000144420
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:GTF2I 35 109 7.6e-33 PFAM
Pfam:GTF2I 167 193 4.2e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202280
AA Change: D872G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: D872G

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202321
Predicted Effect probably benign
Transcript: ENSMUST00000202554
AA Change: D853G

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: D853G

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202829
AA Change: D172G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144604
Gene: ENSMUSG00000023079
AA Change: D172G

DomainStartEndE-ValueType
Pfam:GTF2I 1 44 1.4e-15 PFAM
Pfam:GTF2I 87 161 4.6e-34 PFAM
Pfam:GTF2I 190 264 4.6e-34 PFAM
low complexity region 293 316 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134358891 missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134379978 missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134377041 missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134358824 makesense probably null
IGL02963:Gtf2ird1 APN 5 134389687 missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134389129 critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134382538 missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134376942 missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134411064 missense possibly damaging 0.85
R1388:Gtf2ird1 UTSW 5 134395710 missense probably damaging 1.00
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134358918 missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134395713 missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134366936 splice site probably null
R1852:Gtf2ird1 UTSW 5 134382580 splice site probably null
R1938:Gtf2ird1 UTSW 5 134415245 missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134376886 splice site probably benign
R2020:Gtf2ird1 UTSW 5 134417093 missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134363934 missense probably damaging 1.00
R2849:Gtf2ird1 UTSW 5 134359007 missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134357684 splice site probably null
R3421:Gtf2ird1 UTSW 5 134388500 missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134363900 critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134411003 missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4666:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134357881 missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134404734 missense probably benign
R4806:Gtf2ird1 UTSW 5 134383896 missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134395722 missense probably damaging 1.00
R4857:Gtf2ird1 UTSW 5 134362544 missense probably damaging 0.96
R4970:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134357831 nonsense probably null
R4975:Gtf2ird1 UTSW 5 134395627 missense probably damaging 1.00
R5072:Gtf2ird1 UTSW 5 134390933 splice site probably null
R5112:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134410967 missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134363318 missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134383818 missense probably damaging 1.00
R5753:Gtf2ird1 UTSW 5 134410983 missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134404690 missense probably benign 0.19
R6580:Gtf2ird1 UTSW 5 134361039 missense probably damaging 1.00
R6787:Gtf2ird1 UTSW 5 134363912 missense probably damaging 0.99
R6981:Gtf2ird1 UTSW 5 134383922 splice site probably benign
R7208:Gtf2ird1 UTSW 5 134411094 missense probably benign 0.35
R7271:Gtf2ird1 UTSW 5 134404904 missense probably benign 0.01
R7786:Gtf2ird1 UTSW 5 134390899 nonsense probably null
R7788:Gtf2ird1 UTSW 5 134417131 nonsense probably null
R7850:Gtf2ird1 UTSW 5 134363215 missense probably benign 0.21
R7866:Gtf2ird1 UTSW 5 134363209 missense probably benign 0.01
R8183:Gtf2ird1 UTSW 5 134357835 missense unknown
R8712:Gtf2ird1 UTSW 5 134415210 missense probably damaging 1.00
R8844:Gtf2ird1 UTSW 5 134361025 nonsense probably null
X0026:Gtf2ird1 UTSW 5 134376102 splice site probably null
Z1176:Gtf2ird1 UTSW 5 134409312 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTACAGCTTAGCTCACTCTG -3'
(R):5'- CCTGAGTCAGAAGATCAACTCC -3'

Sequencing Primer
(F):5'- CAGCTTAGCTCACTCTGTTTTAAAGG -3'
(R):5'- GGAAGGATGTTTCCCATGACCTATC -3'
Posted On2019-10-17