Incidental Mutation 'R7517:Pon2'
ID 582515
Institutional Source Beutler Lab
Gene Symbol Pon2
Ensembl Gene ENSMUSG00000032667
Gene Name paraoxonase 2
Synonyms 6330405I24Rik
MMRRC Submission 045590-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7517 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 5264620-5298408 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 5268997 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Histidine at position 226 (N226H)
Ref Sequence ENSEMBL: ENSMUSP00000062670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057792]
AlphaFold Q62086
Predicted Effect possibly damaging
Transcript: ENSMUST00000057792
AA Change: N226H

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062670
Gene: ENSMUSG00000032667
AA Change: N226H

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SGL 107 303 1e-12 PFAM
Pfam:Arylesterase 167 252 3.9e-43 PFAM
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed an atherogenic diet, mice homozygous for a gene trapped allele show markedly lower VLDL/LDL cholesterol and serum apoB levels, higher cellular oxidative stress, enhanced macrophage immunoreactivity and LDL-induced monocyte chemotaxis, and largeratheromatous lesions than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,437,331 (GRCm39) V578E possibly damaging Het
Arhgap35 A T 7: 16,296,132 (GRCm39) C978S probably benign Het
Asph A T 4: 9,517,697 (GRCm39) V475E probably damaging Het
Atf7ip2 T A 16: 10,059,399 (GRCm39) probably null Het
Bace1 A T 9: 45,771,559 (GRCm39) D491V probably benign Het
Birc2 A G 9: 7,819,424 (GRCm39) I496T probably benign Het
Cacna2d4 C T 6: 119,248,882 (GRCm39) R448C probably benign Het
Ccdc181 T C 1: 164,107,989 (GRCm39) F224S probably damaging Het
Cdan1 C T 2: 120,558,405 (GRCm39) R469Q probably damaging Het
Ddx21 G A 10: 62,424,569 (GRCm39) P544L probably damaging Het
Epas1 C A 17: 87,138,526 (GRCm39) T874N possibly damaging Het
Fam13b A T 18: 34,627,660 (GRCm39) D180E probably damaging Het
Fcgbp G A 7: 27,784,794 (GRCm39) V285M probably damaging Het
Gcn1 T G 5: 115,757,755 (GRCm39) L2487V probably benign Het
Gm19410 C T 8: 36,240,772 (GRCm39) A216V possibly damaging Het
Gm4871 G T 5: 144,969,430 (GRCm39) R30S probably damaging Het
Gtf2ird1 T C 5: 134,391,379 (GRCm39) D899G probably benign Het
Hipk3 T C 2: 104,265,059 (GRCm39) T674A probably benign Het
Hnrnph3 A G 10: 62,854,674 (GRCm39) L39S unknown Het
Ift122 T C 6: 115,867,543 (GRCm39) V431A probably benign Het
Il36b A G 2: 24,049,890 (GRCm39) H167R probably benign Het
Lce3e T A 3: 92,875,142 (GRCm39) C33S unknown Het
Lrrc26 T C 2: 25,180,545 (GRCm39) I182T probably benign Het
Magi1 T C 6: 93,685,189 (GRCm39) R730G probably damaging Het
Meis3 G T 7: 15,911,743 (GRCm39) V102F probably damaging Het
Mpp7 G A 18: 7,440,183 (GRCm39) Q263* probably null Het
Myo7b A T 18: 32,146,320 (GRCm39) I155N probably damaging Het
Nrip1 A T 16: 76,088,072 (GRCm39) *1162K probably null Het
Or3a1b T A 11: 74,012,335 (GRCm39) D73E probably damaging Het
Or4k50-ps1 T C 2: 111,522,444 (GRCm39) F194L unknown Het
Or8i2 A C 2: 86,852,486 (GRCm39) V134G probably benign Het
Pdik1l T A 4: 134,005,736 (GRCm39) E326V possibly damaging Het
Phrf1 T C 7: 140,836,523 (GRCm39) M265T unknown Het
Piezo2 A T 18: 63,215,996 (GRCm39) N1222K possibly damaging Het
Pkd1 G A 17: 24,799,393 (GRCm39) V2871M probably damaging Het
Rftn2 G T 1: 55,234,708 (GRCm39) D338E probably damaging Het
Rnf123 A T 9: 107,947,473 (GRCm39) Y171* probably null Het
Ror2 A T 13: 53,264,901 (GRCm39) N730K possibly damaging Het
Serpinb6c T A 13: 34,079,278 (GRCm39) N138I probably damaging Het
Smco1 A T 16: 32,092,785 (GRCm39) H152L possibly damaging Het
Tgm3 T G 2: 129,883,684 (GRCm39) S447R probably benign Het
Topbp1 A G 9: 103,209,932 (GRCm39) K860E possibly damaging Het
Uba7 C A 9: 107,853,897 (GRCm39) probably benign Het
Ucp3 A G 7: 100,131,089 (GRCm39) N181D probably damaging Het
Unc13b C A 4: 43,215,765 (GRCm39) S21R probably benign Het
Usp34 T A 11: 23,396,968 (GRCm39) S2395R Het
Other mutations in Pon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Pon2 APN 6 5,272,331 (GRCm39) missense probably damaging 1.00
IGL02683:Pon2 APN 6 5,269,062 (GRCm39) missense probably damaging 1.00
IGL03240:Pon2 APN 6 5,265,316 (GRCm39) utr 3 prime probably benign
R0102:Pon2 UTSW 6 5,289,091 (GRCm39) splice site probably benign
R0102:Pon2 UTSW 6 5,289,091 (GRCm39) splice site probably benign
R0360:Pon2 UTSW 6 5,266,156 (GRCm39) nonsense probably null
R0364:Pon2 UTSW 6 5,266,156 (GRCm39) nonsense probably null
R0402:Pon2 UTSW 6 5,272,410 (GRCm39) nonsense probably null
R0494:Pon2 UTSW 6 5,267,059 (GRCm39) splice site probably benign
R1593:Pon2 UTSW 6 5,273,003 (GRCm39) missense probably benign
R3001:Pon2 UTSW 6 5,268,976 (GRCm39) critical splice donor site probably null
R3002:Pon2 UTSW 6 5,268,976 (GRCm39) critical splice donor site probably null
R3236:Pon2 UTSW 6 5,266,986 (GRCm39) missense possibly damaging 0.59
R4467:Pon2 UTSW 6 5,267,021 (GRCm39) missense probably benign 0.24
R4911:Pon2 UTSW 6 5,269,029 (GRCm39) missense possibly damaging 0.93
R5237:Pon2 UTSW 6 5,265,455 (GRCm39) missense probably benign
R6025:Pon2 UTSW 6 5,289,057 (GRCm39) missense probably benign 0.40
R6313:Pon2 UTSW 6 5,272,421 (GRCm39) missense probably damaging 1.00
R6737:Pon2 UTSW 6 5,266,183 (GRCm39) missense probably benign 0.04
R7427:Pon2 UTSW 6 5,268,995 (GRCm39) missense probably damaging 0.99
R7438:Pon2 UTSW 6 5,289,080 (GRCm39) missense probably benign
R8142:Pon2 UTSW 6 5,266,239 (GRCm39) missense probably benign 0.01
R8318:Pon2 UTSW 6 5,265,425 (GRCm39) missense probably benign
R8863:Pon2 UTSW 6 5,265,480 (GRCm39) critical splice acceptor site probably null
R9154:Pon2 UTSW 6 5,265,391 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCATCAACAGAGAAATGGTTAAGTC -3'
(R):5'- ACATCATAGCTGTTGGGCCC -3'

Sequencing Primer
(F):5'- TTGAAGGAGGAATTTTAAAACCTGG -3'
(R):5'- GGCCCACCCACTTCTACG -3'
Posted On 2019-10-17