Incidental Mutation 'R7517:Pon2'
ID582515
Institutional Source Beutler Lab
Gene Symbol Pon2
Ensembl Gene ENSMUSG00000032667
Gene Nameparaoxonase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location5264147-5298455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 5268997 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 226 (N226H)
Ref Sequence ENSEMBL: ENSMUSP00000062670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057792]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057792
AA Change: N226H

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062670
Gene: ENSMUSG00000032667
AA Change: N226H

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SGL 107 303 1e-12 PFAM
Pfam:Arylesterase 167 252 3.9e-43 PFAM
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed an atherogenic diet, mice homozygous for a gene trapped allele show markedly lower VLDL/LDL cholesterol and serum apoB levels, higher cellular oxidative stress, enhanced macrophage immunoreactivity and LDL-induced monocyte chemotaxis, and largeratheromatous lesions than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Pon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Pon2 APN 6 5272331 missense probably damaging 1.00
IGL02683:Pon2 APN 6 5269062 missense probably damaging 1.00
IGL03240:Pon2 APN 6 5265316 utr 3 prime probably benign
R0102:Pon2 UTSW 6 5289091 splice site probably benign
R0102:Pon2 UTSW 6 5289091 splice site probably benign
R0360:Pon2 UTSW 6 5266156 nonsense probably null
R0364:Pon2 UTSW 6 5266156 nonsense probably null
R0402:Pon2 UTSW 6 5272410 nonsense probably null
R0494:Pon2 UTSW 6 5267059 splice site probably benign
R1593:Pon2 UTSW 6 5273003 missense probably benign
R3001:Pon2 UTSW 6 5268976 critical splice donor site probably null
R3002:Pon2 UTSW 6 5268976 critical splice donor site probably null
R3236:Pon2 UTSW 6 5266986 missense possibly damaging 0.59
R4467:Pon2 UTSW 6 5267021 missense probably benign 0.24
R4911:Pon2 UTSW 6 5269029 missense possibly damaging 0.93
R5237:Pon2 UTSW 6 5265455 missense probably benign
R6025:Pon2 UTSW 6 5289057 missense probably benign 0.40
R6313:Pon2 UTSW 6 5272421 missense probably damaging 1.00
R6737:Pon2 UTSW 6 5266183 missense probably benign 0.04
R7427:Pon2 UTSW 6 5268995 missense probably damaging 0.99
R7438:Pon2 UTSW 6 5289080 missense probably benign
R8142:Pon2 UTSW 6 5266239 missense probably benign 0.01
R8318:Pon2 UTSW 6 5265425 missense probably benign
R8863:Pon2 UTSW 6 5265480 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCATCAACAGAGAAATGGTTAAGTC -3'
(R):5'- ACATCATAGCTGTTGGGCCC -3'

Sequencing Primer
(F):5'- TTGAAGGAGGAATTTTAAAACCTGG -3'
(R):5'- GGCCCACCCACTTCTACG -3'
Posted On2019-10-17