Mutagenetix > Incidental Mutation

Incidental Mutation 'R7517:Cacna2d4'

582518

Institutional Source

Beutler Lab

Gene Symbol

Cacna2d4

Ensembl Gene

ENSMUSG00000041460

Gene Name

calcium channel, voltage-dependent, alpha 2/delta subunit 4

Synonyms

5730412N02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7517 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119236526-119352407 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119271921 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 448 (R448C)

Ref Sequence

ENSEMBL: ENSMUSP00000140197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000186622]

AlphaFold

Q5RJF7

Predicted Effect

probably benign
Transcript: ENSMUST00000037434
AA Change: R448C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460
AA Change: R448C

Domain	Start	End	E-Value	Type
Blast:WNT1	79	144	1e-13	BLAST
Pfam:VWA_N	155	271	7.3e-40	PFAM
VWA	296	481	4.37e-14	SMART
Pfam:Cache_1	494	586	1.1e-24	PFAM
low complexity region	837	849	N/A	INTRINSIC
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1000	1011	N/A	INTRINSIC
low complexity region	1120	1143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186622
AA Change: R448C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460
AA Change: R448C

Domain	Start	End	E-Value	Type
Blast:WNT1	79	144	1e-13	BLAST
Pfam:VWA_N	155	271	6.4e-44	PFAM
VWA	296	481	2.7e-16	SMART
Pfam:Cache_1	494	559	1.1e-7	PFAM
low complexity region	812	824	N/A	INTRINSIC
low complexity region	950	959	N/A	INTRINSIC
low complexity region	975	986	N/A	INTRINSIC
low complexity region	1095	1118	N/A	INTRINSIC

Meta Mutation Damage Score

0.1459

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	A	T	14: 31,715,374	V578E	possibly damaging	Het
Arhgap35	A	T	7: 16,562,207	C978S	probably benign	Het
Asph	A	T	4: 9,517,697	V475E	probably damaging	Het
Atf7ip2	T	A	16: 10,241,535		probably null	Het
Bace1	A	T	9: 45,860,261	D491V	probably benign	Het
Birc2	A	G	9: 7,819,423	I496T	probably benign	Het
Ccdc181	T	C	1: 164,280,420	F224S	probably damaging	Het
Cdan1	C	T	2: 120,727,924	R469Q	probably damaging	Het
Ddx21	G	A	10: 62,588,790	P544L	probably damaging	Het
Epas1	C	A	17: 86,831,098	T874N	possibly damaging	Het
Fam13b	A	T	18: 34,494,607	D180E	probably damaging	Het
Fcgbp	G	A	7: 28,085,369	V285M	probably damaging	Het
Gcn1l1	T	G	5: 115,619,696	L2487V	probably benign	Het
Gm19410	C	T	8: 35,773,618	A216V	possibly damaging	Het
Gm4871	G	T	5: 145,032,620	R30S	probably damaging	Het
Gtf2ird1	T	C	5: 134,362,525	D899G	probably benign	Het
Hipk3	T	C	2: 104,434,714	T674A	probably benign	Het
Hnrnph3	A	G	10: 63,018,895	L39S	unknown	Het
Ift122	T	C	6: 115,890,582	V431A	probably benign	Het
Il1f8	A	G	2: 24,159,878	H167R	probably benign	Het
Lce3e	T	A	3: 92,967,835	C33S	unknown	Het
Lrrc26	T	C	2: 25,290,533	I182T	probably benign	Het
Magi1	T	C	6: 93,708,208	R730G	probably damaging	Het
Meis3	G	T	7: 16,177,818	V102F	probably damaging	Het
Mpp7	G	A	18: 7,440,183	Q263*	probably null	Het
Myo7b	A	T	18: 32,013,267	I155N	probably damaging	Het
Nrip1	A	T	16: 76,291,184	*1162K	probably null	Het
Olfr1104	A	C	2: 87,022,142	V134G	probably benign	Het
Olfr1300-ps1	T	C	2: 111,692,099	F194L	unknown	Het
Olfr401	T	A	11: 74,121,509	D73E	probably damaging	Het
Pdik1l	T	A	4: 134,278,425	E326V	possibly damaging	Het
Phrf1	T	C	7: 141,256,610	M265T	unknown	Het
Piezo2	A	T	18: 63,082,925	N1222K	possibly damaging	Het
Pkd1	G	A	17: 24,580,419	V2871M	probably damaging	Het
Pon2	T	G	6: 5,268,997	N226H	possibly damaging	Het
Rftn2	G	T	1: 55,195,549	D338E	probably damaging	Het
Rnf123	A	T	9: 108,070,274	Y171*	probably null	Het
Ror2	A	T	13: 53,110,865	N730K	possibly damaging	Het
Serpinb6c	T	A	13: 33,895,295	N138I	probably damaging	Het
Smco1	A	T	16: 32,273,967	H152L	possibly damaging	Het
Tgm3	T	G	2: 130,041,764	S447R	probably benign	Het
Topbp1	A	G	9: 103,332,733	K860E	possibly damaging	Het
Uba7	C	A	9: 107,976,698		probably benign	Het
Ucp3	A	G	7: 100,481,882	N181D	probably damaging	Het
Unc13b	C	A	4: 43,215,765	S21R	probably benign	Het
Usp34	T	A	11: 23,446,968	S2395R		Het

Other mutations in Cacna2d4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Cacna2d4	APN	6	119337933	splice site	probably benign
IGL00469:Cacna2d4	APN	6	119268278	missense	probably damaging	1.00
IGL00518:Cacna2d4	APN	6	119343575	missense	probably damaging	1.00
IGL00946:Cacna2d4	APN	6	119271915	missense	possibly damaging	0.82
IGL01447:Cacna2d4	APN	6	119242904	missense	probably damaging	1.00
IGL01514:Cacna2d4	APN	6	119282173	splice site	probably benign
IGL01576:Cacna2d4	APN	6	119281641	nonsense	probably null
IGL01934:Cacna2d4	APN	6	119308768	missense	probably damaging	1.00
IGL02231:Cacna2d4	APN	6	119277908	splice site	probably benign
IGL02516:Cacna2d4	APN	6	119271870	splice site	probably benign
IGL02688:Cacna2d4	APN	6	119270749	splice site	probably null
IGL03110:Cacna2d4	APN	6	119236737	missense	probably benign	0.05
IGL03365:Cacna2d4	APN	6	119271264	missense	probably benign	0.15
saccharine	UTSW	6	119345106	splice site	probably benign
Steveo	UTSW	6	119347252	critical splice donor site	probably null
Sussmann	UTSW	6	119274318	missense	probably damaging	1.00
R0139:Cacna2d4	UTSW	6	119278269	intron	probably benign
R0157:Cacna2d4	UTSW	6	119312424	missense	probably benign	0.00
R0158:Cacna2d4	UTSW	6	119236748	missense	possibly damaging	0.68
R0245:Cacna2d4	UTSW	6	119308721	missense	probably damaging	1.00
R0612:Cacna2d4	UTSW	6	119281718	splice site	probably benign
R0659:Cacna2d4	UTSW	6	119345106	splice site	probably benign
R0722:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0743:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0833:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0835:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0836:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R0884:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1052:Cacna2d4	UTSW	6	119300333	missense	probably damaging	1.00
R1168:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1170:Cacna2d4	UTSW	6	119307286	missense	probably damaging	1.00
R1451:Cacna2d4	UTSW	6	119236824	missense	probably benign	0.01
R1564:Cacna2d4	UTSW	6	119241195	missense	possibly damaging	0.67
R1809:Cacna2d4	UTSW	6	119270824	missense	probably damaging	0.99
R1936:Cacna2d4	UTSW	6	119270761	missense	possibly damaging	0.82
R2078:Cacna2d4	UTSW	6	119338116	missense	probably benign	0.02
R2198:Cacna2d4	UTSW	6	119347259	splice site	probably benign
R2280:Cacna2d4	UTSW	6	119350041	missense	possibly damaging	0.85
R3757:Cacna2d4	UTSW	6	119241163	missense	probably damaging	0.98
R3975:Cacna2d4	UTSW	6	119278173	splice site	probably null
R3976:Cacna2d4	UTSW	6	119278173	splice site	probably null
R4238:Cacna2d4	UTSW	6	119240708	missense	probably null	1.00
R4591:Cacna2d4	UTSW	6	119298464	missense	probably benign	0.02
R4856:Cacna2d4	UTSW	6	119278256	missense	possibly damaging	0.90
R4899:Cacna2d4	UTSW	6	119268196	nonsense	probably null
R5319:Cacna2d4	UTSW	6	119347252	critical splice donor site	probably null
R5351:Cacna2d4	UTSW	6	119268201	missense	probably damaging	1.00
R5366:Cacna2d4	UTSW	6	119274318	missense	probably damaging	1.00
R5393:Cacna2d4	UTSW	6	119239054	missense	probably benign	0.20
R5395:Cacna2d4	UTSW	6	119271418	missense	possibly damaging	0.71
R5408:Cacna2d4	UTSW	6	119348791	missense	probably damaging	1.00
R5603:Cacna2d4	UTSW	6	119244285	missense	probably damaging	1.00
R5661:Cacna2d4	UTSW	6	119343531	missense	probably benign
R5898:Cacna2d4	UTSW	6	119274231	missense	probably damaging	1.00
R5928:Cacna2d4	UTSW	6	119281698	missense	probably benign	0.06
R6186:Cacna2d4	UTSW	6	119281689	missense	possibly damaging	0.94
R6218:Cacna2d4	UTSW	6	119239060	missense	probably damaging	0.99
R6257:Cacna2d4	UTSW	6	119281619	critical splice acceptor site	probably null
R6409:Cacna2d4	UTSW	6	119282228	missense	probably damaging	0.99
R6931:Cacna2d4	UTSW	6	119282234	missense	possibly damaging	0.49
R7221:Cacna2d4	UTSW	6	119236663	missense	probably benign	0.02
R7363:Cacna2d4	UTSW	6	119343978	missense	probably damaging	1.00
R7371:Cacna2d4	UTSW	6	119308709	missense	probably benign	0.07
R7382:Cacna2d4	UTSW	6	119239087	missense	probably damaging	1.00
R7431:Cacna2d4	UTSW	6	119244276	missense	probably damaging	0.98
R7527:Cacna2d4	UTSW	6	119271247	missense	probably benign	0.00
R7529:Cacna2d4	UTSW	6	119270766	missense	probably benign	0.01
R7710:Cacna2d4	UTSW	6	119274239	missense	probably benign	0.05
R7880:Cacna2d4	UTSW	6	119349155	missense	probably damaging	0.99
R8007:Cacna2d4	UTSW	6	119312444	missense	probably benign
R8084:Cacna2d4	UTSW	6	119300352	missense	probably damaging	1.00
R8159:Cacna2d4	UTSW	6	119297527	missense	probably benign	0.01
R8391:Cacna2d4	UTSW	6	119348745	missense	probably benign	0.04
R8700:Cacna2d4	UTSW	6	119281693	missense	probably damaging	1.00
R8857:Cacna2d4	UTSW	6	119271948	nonsense	probably null
R8973:Cacna2d4	UTSW	6	119241181	missense	probably damaging	1.00
R8976:Cacna2d4	UTSW	6	119338157	missense	possibly damaging	0.79
R8998:Cacna2d4	UTSW	6	119242915	missense	possibly damaging	0.90
R9129:Cacna2d4	UTSW	6	119336454	critical splice donor site	probably null
R9199:Cacna2d4	UTSW	6	119267826	missense	probably benign	0.12
R9228:Cacna2d4	UTSW	6	119271515	missense	probably benign	0.07
R9310:Cacna2d4	UTSW	6	119271953	critical splice donor site	probably null
R9315:Cacna2d4	UTSW	6	119236709	missense	probably benign
R9335:Cacna2d4	UTSW	6	119302053	missense	probably damaging	1.00
R9416:Cacna2d4	UTSW	6	119297518	missense	probably benign	0.06
R9514:Cacna2d4	UTSW	6	119236650	missense	probably benign
R9600:Cacna2d4	UTSW	6	119345062	missense	probably benign	0.02
RF023:Cacna2d4	UTSW	6	119268230	missense	probably benign	0.19
Z1176:Cacna2d4	UTSW	6	119312450	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- CAAAGTTACAGCAGCCTGGG -3'
(R):5'- CTTCAGAGAAATCTGCCCTCC -3'

Sequencing Primer
(F):5'- TGTAAGAGGCTGCAGGGC -3'
(R):5'- CCTTTCTCTGAACAACGGGG -3'

Posted On

2019-10-17