Incidental Mutation 'R7517:Meis3'
ID582519
Institutional Source Beutler Lab
Gene Symbol Meis3
Ensembl Gene ENSMUSG00000041420
Gene NameMeis homeobox 3
SynonymsMrg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16175090-16186504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16177818 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 102 (V102F)
Ref Sequence ENSEMBL: ENSMUSP00000002495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002495] [ENSMUST00000176342] [ENSMUST00000176446] [ENSMUST00000176506] [ENSMUST00000177156] [ENSMUST00000177540]
Predicted Effect probably damaging
Transcript: ENSMUST00000002495
AA Change: V102F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002495
Gene: ENSMUSG00000041420
AA Change: V102F

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
HOX 265 330 9.15e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176342
AA Change: V102F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135302
Gene: ENSMUSG00000041420
AA Change: V102F

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176446
Predicted Effect probably damaging
Transcript: ENSMUST00000176506
AA Change: V102F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134918
Gene: ENSMUSG00000041420
AA Change: V102F

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
HOX 248 313 9.15e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177156
AA Change: V102F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135103
Gene: ENSMUSG00000041420
AA Change: V102F

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
Pfam:Homeobox_KN 283 313 2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177540
AA Change: V102F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135388
Gene: ENSMUSG00000041420
AA Change: V102F

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: The protein encoding this gene belongs to the three amino acid loop extension family of homeodomain transcription factors, which play essential roles in many embryonic processes. These proteins are characterized by an atypical homeodomain containing a three amino acid loop extension between helices 1 and 2. Expression of this gene begins during the compaction stage of embryogenesis and continues into the blastocyst stage. This gene is also expressed in pancreatic islet cells and beta-cells and regulates beta-cell survival. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Meis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Meis3 APN 7 16178947 critical splice acceptor site probably benign 0.00
IGL02508:Meis3 APN 7 16178797 splice site probably null
IGL03125:Meis3 APN 7 16178770 missense probably damaging 1.00
IGL03383:Meis3 APN 7 16183819 missense probably damaging 1.00
R0032:Meis3 UTSW 7 16182285 unclassified probably benign
R1147:Meis3 UTSW 7 16183776 unclassified probably benign
R1471:Meis3 UTSW 7 16177571 nonsense probably null
R3054:Meis3 UTSW 7 16182453 missense probably damaging 1.00
R3927:Meis3 UTSW 7 16177494 missense probably benign 0.06
R5314:Meis3 UTSW 7 16184064 missense probably damaging 0.99
R6713:Meis3 UTSW 7 16182330 nonsense probably null
R6847:Meis3 UTSW 7 16183864 missense probably damaging 1.00
R7218:Meis3 UTSW 7 16184701 missense probably benign
R7540:Meis3 UTSW 7 16177493 nonsense probably null
R7699:Meis3 UTSW 7 16177556 missense probably benign
R7700:Meis3 UTSW 7 16177556 missense probably benign
R7790:Meis3 UTSW 7 16182397 missense probably benign 0.37
R8902:Meis3 UTSW 7 16177962 missense probably benign 0.17
R8909:Meis3 UTSW 7 16185460 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCCAGAGTGTCCTTTGTGTC -3'
(R):5'- CAACCCCAGGAATACAGGTG -3'

Sequencing Primer
(F):5'- CAGAGTGTCCTTTGTGTCTCTCAG -3'
(R):5'- ACCAGGTTGTCCAGCTCC -3'
Posted On2019-10-17