Incidental Mutation 'R7517:Gm19410'
ID582524
Institutional Source Beutler Lab
Gene Symbol Gm19410
Ensembl Gene ENSMUSG00000109372
Gene Namepredicted gene, 19410
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location35765790-35818047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35773618 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 216 (A216V)
Ref Sequence ENSEMBL: ENSMUSP00000147162 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207505
AA Change: A216V

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Birc2 A G 9: 7,819,423 I496T probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Gm19410
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Gm19410 UTSW 8 35795599 missense probably damaging 0.98
BB019:Gm19410 UTSW 8 35795599 missense probably damaging 0.98
R0046:Gm19410 UTSW 8 35802645 missense probably benign 0.31
R6026:Gm19410 UTSW 8 35812426 missense probably benign 0.03
R6039:Gm19410 UTSW 8 35809364 missense probably benign 0.44
R6039:Gm19410 UTSW 8 35809364 missense probably benign 0.44
R6185:Gm19410 UTSW 8 35807510 missense possibly damaging 0.87
R6239:Gm19410 UTSW 8 35778764 missense probably damaging 0.98
R6303:Gm19410 UTSW 8 35807560 missense possibly damaging 0.96
R6377:Gm19410 UTSW 8 35803582 nonsense probably null
R6545:Gm19410 UTSW 8 35790498 missense possibly damaging 0.93
R6700:Gm19410 UTSW 8 35807510 missense possibly damaging 0.87
R6720:Gm19410 UTSW 8 35807576 missense probably benign 0.12
R6795:Gm19410 UTSW 8 35795522 missense probably damaging 0.98
R6808:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6810:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6811:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6966:Gm19410 UTSW 8 35817973 missense possibly damaging 0.84
R7264:Gm19410 UTSW 8 35785766 missense probably benign 0.01
R7267:Gm19410 UTSW 8 35814843 missense possibly damaging 0.80
R7355:Gm19410 UTSW 8 35807072 missense probably benign 0.00
R7423:Gm19410 UTSW 8 35804607 missense probably benign 0.28
R7494:Gm19410 UTSW 8 35795530 missense probably damaging 0.99
R7516:Gm19410 UTSW 8 35796279 missense probably benign 0.30
R7526:Gm19410 UTSW 8 35790612 missense probably damaging 0.98
R7527:Gm19410 UTSW 8 35802232 missense probably damaging 0.99
R7545:Gm19410 UTSW 8 35802625 missense probably damaging 0.99
R7549:Gm19410 UTSW 8 35799346 missense probably benign 0.20
R7564:Gm19410 UTSW 8 35806997 missense probably benign 0.00
R7615:Gm19410 UTSW 8 35796359 missense probably damaging 1.00
R7622:Gm19410 UTSW 8 35810347 missense possibly damaging 0.91
R7655:Gm19410 UTSW 8 35809099 missense probably benign
R7656:Gm19410 UTSW 8 35809099 missense probably benign
R7703:Gm19410 UTSW 8 35799385 missense probably damaging 0.98
R7750:Gm19410 UTSW 8 35807498 missense possibly damaging 0.68
R7760:Gm19410 UTSW 8 35802337 missense probably damaging 0.99
R7837:Gm19410 UTSW 8 35808980 missense possibly damaging 0.91
R7932:Gm19410 UTSW 8 35795599 missense probably damaging 0.98
R7942:Gm19410 UTSW 8 35771786 missense probably damaging 0.98
R7970:Gm19410 UTSW 8 35815647 missense probably benign 0.00
R8088:Gm19410 UTSW 8 35806841 missense probably benign 0.45
R8228:Gm19410 UTSW 8 35785838 missense possibly damaging 0.53
R8382:Gm19410 UTSW 8 35809148 missense probably damaging 0.99
R8757:Gm19410 UTSW 8 35808965 missense possibly damaging 0.83
R8879:Gm19410 UTSW 8 35771868 missense probably damaging 0.99
Z1176:Gm19410 UTSW 8 35792611 missense possibly damaging 0.79
Z1177:Gm19410 UTSW 8 35808965 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACGTAACCTACTGAAAGAGTTGTCTT -3'
(R):5'- ATAAGGGACAAAGATAACTGCCT -3'

Sequencing Primer
(F):5'- AAGAGTTGTCTTTCTACACTCCTG -3'
(R):5'- CAAGCATTCTCTCAAGGAGTTGGTC -3'
Posted On2019-10-17