Incidental Mutation 'R7517:Gm19410'
ID 582524
Institutional Source Beutler Lab
Gene Symbol Gm19410
Ensembl Gene ENSMUSG00000109372
Gene Name predicted gene, 19410
Synonyms
MMRRC Submission 045590-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R7517 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 36232944-36285201 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36240772 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 216 (A216V)
Ref Sequence ENSEMBL: ENSMUSP00000147162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000207505]
AlphaFold A0A140LJC7
Predicted Effect possibly damaging
Transcript: ENSMUST00000207505
AA Change: A216V

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,437,331 (GRCm39) V578E possibly damaging Het
Arhgap35 A T 7: 16,296,132 (GRCm39) C978S probably benign Het
Asph A T 4: 9,517,697 (GRCm39) V475E probably damaging Het
Atf7ip2 T A 16: 10,059,399 (GRCm39) probably null Het
Bace1 A T 9: 45,771,559 (GRCm39) D491V probably benign Het
Birc2 A G 9: 7,819,424 (GRCm39) I496T probably benign Het
Cacna2d4 C T 6: 119,248,882 (GRCm39) R448C probably benign Het
Ccdc181 T C 1: 164,107,989 (GRCm39) F224S probably damaging Het
Cdan1 C T 2: 120,558,405 (GRCm39) R469Q probably damaging Het
Ddx21 G A 10: 62,424,569 (GRCm39) P544L probably damaging Het
Epas1 C A 17: 87,138,526 (GRCm39) T874N possibly damaging Het
Fam13b A T 18: 34,627,660 (GRCm39) D180E probably damaging Het
Fcgbp G A 7: 27,784,794 (GRCm39) V285M probably damaging Het
Gcn1 T G 5: 115,757,755 (GRCm39) L2487V probably benign Het
Gm4871 G T 5: 144,969,430 (GRCm39) R30S probably damaging Het
Gtf2ird1 T C 5: 134,391,379 (GRCm39) D899G probably benign Het
Hipk3 T C 2: 104,265,059 (GRCm39) T674A probably benign Het
Hnrnph3 A G 10: 62,854,674 (GRCm39) L39S unknown Het
Ift122 T C 6: 115,867,543 (GRCm39) V431A probably benign Het
Il36b A G 2: 24,049,890 (GRCm39) H167R probably benign Het
Lce3e T A 3: 92,875,142 (GRCm39) C33S unknown Het
Lrrc26 T C 2: 25,180,545 (GRCm39) I182T probably benign Het
Magi1 T C 6: 93,685,189 (GRCm39) R730G probably damaging Het
Meis3 G T 7: 15,911,743 (GRCm39) V102F probably damaging Het
Mpp7 G A 18: 7,440,183 (GRCm39) Q263* probably null Het
Myo7b A T 18: 32,146,320 (GRCm39) I155N probably damaging Het
Nrip1 A T 16: 76,088,072 (GRCm39) *1162K probably null Het
Or3a1b T A 11: 74,012,335 (GRCm39) D73E probably damaging Het
Or4k50-ps1 T C 2: 111,522,444 (GRCm39) F194L unknown Het
Or8i2 A C 2: 86,852,486 (GRCm39) V134G probably benign Het
Pdik1l T A 4: 134,005,736 (GRCm39) E326V possibly damaging Het
Phrf1 T C 7: 140,836,523 (GRCm39) M265T unknown Het
Piezo2 A T 18: 63,215,996 (GRCm39) N1222K possibly damaging Het
Pkd1 G A 17: 24,799,393 (GRCm39) V2871M probably damaging Het
Pon2 T G 6: 5,268,997 (GRCm39) N226H possibly damaging Het
Rftn2 G T 1: 55,234,708 (GRCm39) D338E probably damaging Het
Rnf123 A T 9: 107,947,473 (GRCm39) Y171* probably null Het
Ror2 A T 13: 53,264,901 (GRCm39) N730K possibly damaging Het
Serpinb6c T A 13: 34,079,278 (GRCm39) N138I probably damaging Het
Smco1 A T 16: 32,092,785 (GRCm39) H152L possibly damaging Het
Tgm3 T G 2: 129,883,684 (GRCm39) S447R probably benign Het
Topbp1 A G 9: 103,209,932 (GRCm39) K860E possibly damaging Het
Uba7 C A 9: 107,853,897 (GRCm39) probably benign Het
Ucp3 A G 7: 100,131,089 (GRCm39) N181D probably damaging Het
Unc13b C A 4: 43,215,765 (GRCm39) S21R probably benign Het
Usp34 T A 11: 23,396,968 (GRCm39) S2395R Het
Other mutations in Gm19410
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Gm19410 UTSW 8 36,262,753 (GRCm39) missense probably damaging 0.98
BB019:Gm19410 UTSW 8 36,262,753 (GRCm39) missense probably damaging 0.98
R0046:Gm19410 UTSW 8 36,269,799 (GRCm39) missense probably benign 0.31
R6026:Gm19410 UTSW 8 36,279,580 (GRCm39) missense probably benign 0.03
R6039:Gm19410 UTSW 8 36,276,518 (GRCm39) missense probably benign 0.44
R6039:Gm19410 UTSW 8 36,276,518 (GRCm39) missense probably benign 0.44
R6185:Gm19410 UTSW 8 36,274,664 (GRCm39) missense possibly damaging 0.87
R6239:Gm19410 UTSW 8 36,245,918 (GRCm39) missense probably damaging 0.98
R6303:Gm19410 UTSW 8 36,274,714 (GRCm39) missense possibly damaging 0.96
R6377:Gm19410 UTSW 8 36,270,736 (GRCm39) nonsense probably null
R6545:Gm19410 UTSW 8 36,257,652 (GRCm39) missense possibly damaging 0.93
R6700:Gm19410 UTSW 8 36,274,664 (GRCm39) missense possibly damaging 0.87
R6720:Gm19410 UTSW 8 36,274,730 (GRCm39) missense probably benign 0.12
R6795:Gm19410 UTSW 8 36,262,676 (GRCm39) missense probably damaging 0.98
R6808:Gm19410 UTSW 8 36,239,733 (GRCm39) missense probably damaging 0.99
R6810:Gm19410 UTSW 8 36,239,733 (GRCm39) missense probably damaging 0.99
R6811:Gm19410 UTSW 8 36,239,733 (GRCm39) missense probably damaging 0.99
R6966:Gm19410 UTSW 8 36,285,127 (GRCm39) missense possibly damaging 0.84
R7264:Gm19410 UTSW 8 36,252,920 (GRCm39) missense probably benign 0.01
R7267:Gm19410 UTSW 8 36,281,997 (GRCm39) missense possibly damaging 0.80
R7355:Gm19410 UTSW 8 36,274,226 (GRCm39) missense probably benign 0.00
R7423:Gm19410 UTSW 8 36,271,761 (GRCm39) missense probably benign 0.28
R7494:Gm19410 UTSW 8 36,262,684 (GRCm39) missense probably damaging 0.99
R7516:Gm19410 UTSW 8 36,263,433 (GRCm39) missense probably benign 0.30
R7526:Gm19410 UTSW 8 36,257,766 (GRCm39) missense probably damaging 0.98
R7527:Gm19410 UTSW 8 36,269,386 (GRCm39) missense probably damaging 0.99
R7545:Gm19410 UTSW 8 36,269,779 (GRCm39) missense probably damaging 0.99
R7549:Gm19410 UTSW 8 36,266,500 (GRCm39) missense probably benign 0.20
R7564:Gm19410 UTSW 8 36,274,151 (GRCm39) missense probably benign 0.00
R7615:Gm19410 UTSW 8 36,263,513 (GRCm39) missense probably damaging 1.00
R7622:Gm19410 UTSW 8 36,277,501 (GRCm39) missense possibly damaging 0.91
R7655:Gm19410 UTSW 8 36,276,253 (GRCm39) missense probably benign
R7656:Gm19410 UTSW 8 36,276,253 (GRCm39) missense probably benign
R7703:Gm19410 UTSW 8 36,266,539 (GRCm39) missense probably damaging 0.98
R7750:Gm19410 UTSW 8 36,274,652 (GRCm39) missense possibly damaging 0.68
R7760:Gm19410 UTSW 8 36,269,491 (GRCm39) missense probably damaging 0.99
R7837:Gm19410 UTSW 8 36,276,134 (GRCm39) missense possibly damaging 0.91
R7932:Gm19410 UTSW 8 36,262,753 (GRCm39) missense probably damaging 0.98
R7942:Gm19410 UTSW 8 36,238,940 (GRCm39) missense probably damaging 0.98
R7970:Gm19410 UTSW 8 36,282,801 (GRCm39) missense probably benign 0.00
R8088:Gm19410 UTSW 8 36,273,995 (GRCm39) missense probably benign 0.45
R8228:Gm19410 UTSW 8 36,252,992 (GRCm39) missense possibly damaging 0.53
R8382:Gm19410 UTSW 8 36,276,302 (GRCm39) missense probably damaging 0.99
R8757:Gm19410 UTSW 8 36,276,119 (GRCm39) missense possibly damaging 0.83
R8879:Gm19410 UTSW 8 36,239,022 (GRCm39) missense probably damaging 0.99
R9010:Gm19410 UTSW 8 36,282,011 (GRCm39) missense probably benign 0.02
R9060:Gm19410 UTSW 8 36,269,480 (GRCm39) missense probably damaging 1.00
R9088:Gm19410 UTSW 8 36,240,766 (GRCm39) missense probably damaging 1.00
R9104:Gm19410 UTSW 8 36,247,621 (GRCm39) missense probably damaging 0.99
R9186:Gm19410 UTSW 8 36,282,629 (GRCm39) missense possibly damaging 0.90
R9290:Gm19410 UTSW 8 36,269,386 (GRCm39) missense probably damaging 0.99
R9334:Gm19410 UTSW 8 36,270,722 (GRCm39) nonsense probably null
R9398:Gm19410 UTSW 8 36,272,356 (GRCm39) missense probably benign 0.00
R9439:Gm19410 UTSW 8 36,248,810 (GRCm39) missense probably damaging 0.96
R9445:Gm19410 UTSW 8 36,239,652 (GRCm39) missense possibly damaging 0.75
R9511:Gm19410 UTSW 8 36,257,848 (GRCm39) missense probably damaging 0.99
R9520:Gm19410 UTSW 8 36,262,637 (GRCm39) missense probably benign 0.15
R9523:Gm19410 UTSW 8 36,257,608 (GRCm39) missense probably benign 0.01
R9669:Gm19410 UTSW 8 36,247,493 (GRCm39) missense possibly damaging 0.45
R9711:Gm19410 UTSW 8 36,279,493 (GRCm39) missense possibly damaging 0.85
R9728:Gm19410 UTSW 8 36,247,594 (GRCm39) missense possibly damaging 0.95
R9759:Gm19410 UTSW 8 36,252,938 (GRCm39) missense possibly damaging 0.53
Z1176:Gm19410 UTSW 8 36,259,765 (GRCm39) missense possibly damaging 0.79
Z1177:Gm19410 UTSW 8 36,276,119 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACGTAACCTACTGAAAGAGTTGTCTT -3'
(R):5'- ATAAGGGACAAAGATAACTGCCT -3'

Sequencing Primer
(F):5'- AAGAGTTGTCTTTCTACACTCCTG -3'
(R):5'- CAAGCATTCTCTCAAGGAGTTGGTC -3'
Posted On 2019-10-17