Incidental Mutation 'R7517:Birc2'
ID582525
Institutional Source Beutler Lab
Gene Symbol Birc2
Ensembl Gene ENSMUSG00000057367
Gene Namebaculoviral IAP repeat-containing 2
SynonymscIAP-1, Api1, HIAP1, IAP1, MIAP1, mcIAP1, MIHB, cIAP1
MMRRC Submission
Accession Numbers

Genbank: NM_007465.2; Ensembl: ENSMUST00000074246

Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R7517 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location7818227-7837064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7819423 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 496 (I496T)
Ref Sequence ENSEMBL: ENSMUSP00000091422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074246] [ENSMUST00000190341]
Predicted Effect probably benign
Transcript: ENSMUST00000074246
AA Change: I496T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091422
Gene: ENSMUSG00000057367
AA Change: I496T

DomainStartEndE-ValueType
BIR 44 115 4.06e-33 SMART
BIR 175 245 4.25e-36 SMART
BIR 260 331 2.24e-35 SMART
low complexity region 432 446 N/A INTRINSIC
CARD 447 535 1.64e-20 SMART
low complexity region 552 563 N/A INTRINSIC
RING 565 599 1.65e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190341
AA Change: I496T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140049
Gene: ENSMUSG00000057367
AA Change: I496T

DomainStartEndE-ValueType
BIR 44 115 4.06e-33 SMART
BIR 175 245 4.25e-36 SMART
BIR 260 331 2.24e-35 SMART
low complexity region 432 446 N/A INTRINSIC
CARD 447 535 1.64e-20 SMART
low complexity region 552 563 N/A INTRINSIC
RING 565 599 1.65e-5 SMART
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice showed a modest reduction in the number of lymphocytes. Mice homozygous for a knock-in allele exhibit increased T cell poliferation and IFNG secretion in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A T 14: 31,715,374 V578E possibly damaging Het
Arhgap35 A T 7: 16,562,207 C978S probably benign Het
Asph A T 4: 9,517,697 V475E probably damaging Het
Atf7ip2 T A 16: 10,241,535 probably null Het
Bace1 A T 9: 45,860,261 D491V probably benign Het
Cacna2d4 C T 6: 119,271,921 R448C probably benign Het
Ccdc181 T C 1: 164,280,420 F224S probably damaging Het
Cdan1 C T 2: 120,727,924 R469Q probably damaging Het
Ddx21 G A 10: 62,588,790 P544L probably damaging Het
Epas1 C A 17: 86,831,098 T874N possibly damaging Het
Fam13b A T 18: 34,494,607 D180E probably damaging Het
Fcgbp G A 7: 28,085,369 V285M probably damaging Het
Gcn1l1 T G 5: 115,619,696 L2487V probably benign Het
Gm19410 C T 8: 35,773,618 A216V possibly damaging Het
Gm4871 G T 5: 145,032,620 R30S probably damaging Het
Gtf2ird1 T C 5: 134,362,525 D899G probably benign Het
Hipk3 T C 2: 104,434,714 T674A probably benign Het
Hnrnph3 A G 10: 63,018,895 L39S unknown Het
Ift122 T C 6: 115,890,582 V431A probably benign Het
Il1f8 A G 2: 24,159,878 H167R probably benign Het
Lce3e T A 3: 92,967,835 C33S unknown Het
Lrrc26 T C 2: 25,290,533 I182T probably benign Het
Magi1 T C 6: 93,708,208 R730G probably damaging Het
Meis3 G T 7: 16,177,818 V102F probably damaging Het
Mpp7 G A 18: 7,440,183 Q263* probably null Het
Myo7b A T 18: 32,013,267 I155N probably damaging Het
Nrip1 A T 16: 76,291,184 *1162K probably null Het
Olfr1104 A C 2: 87,022,142 V134G probably benign Het
Olfr1300-ps1 T C 2: 111,692,099 F194L unknown Het
Olfr401 T A 11: 74,121,509 D73E probably damaging Het
Pdik1l T A 4: 134,278,425 E326V possibly damaging Het
Phrf1 T C 7: 141,256,610 M265T unknown Het
Piezo2 A T 18: 63,082,925 N1222K possibly damaging Het
Pkd1 G A 17: 24,580,419 V2871M probably damaging Het
Pon2 T G 6: 5,268,997 N226H possibly damaging Het
Rftn2 G T 1: 55,195,549 D338E probably damaging Het
Rnf123 A T 9: 108,070,274 Y171* probably null Het
Ror2 A T 13: 53,110,865 N730K possibly damaging Het
Serpinb6c T A 13: 33,895,295 N138I probably damaging Het
Smco1 A T 16: 32,273,967 H152L possibly damaging Het
Tgm3 T G 2: 130,041,764 S447R probably benign Het
Topbp1 A G 9: 103,332,733 K860E possibly damaging Het
Uba7 C A 9: 107,976,698 probably benign Het
Ucp3 A G 7: 100,481,882 N181D probably damaging Het
Unc13b C A 4: 43,215,765 S21R probably benign Het
Usp34 T A 11: 23,446,968 S2395R Het
Other mutations in Birc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Birc2 APN 9 7833665 missense probably damaging 1.00
IGL00972:Birc2 APN 9 7833715 missense probably benign 0.36
IGL02888:Birc2 APN 9 7819558 missense probably benign 0.22
IGL03399:Birc2 APN 9 7821087 missense probably damaging 1.00
1mM(1):Birc2 UTSW 9 7819408 missense probably damaging 0.98
R0409:Birc2 UTSW 9 7819384 missense possibly damaging 0.61
R1617:Birc2 UTSW 9 7826951 missense possibly damaging 0.66
R1864:Birc2 UTSW 9 7819517 missense probably benign 0.06
R2156:Birc2 UTSW 9 7826938 missense probably damaging 1.00
R2519:Birc2 UTSW 9 7821179 missense possibly damaging 0.46
R2867:Birc2 UTSW 9 7834477 start codon destroyed probably null 0.08
R2867:Birc2 UTSW 9 7834477 start codon destroyed probably null 0.08
R4028:Birc2 UTSW 9 7819351 missense probably benign 0.01
R4243:Birc2 UTSW 9 7834385 missense probably benign 0.00
R4250:Birc2 UTSW 9 7818935 missense probably benign 0.00
R4584:Birc2 UTSW 9 7833674 missense probably damaging 1.00
R4952:Birc2 UTSW 9 7836740 missense probably damaging 0.99
R5017:Birc2 UTSW 9 7818885 nonsense probably null
R6163:Birc2 UTSW 9 7819035 missense probably benign 0.15
R6789:Birc2 UTSW 9 7836965 intron probably benign
R6795:Birc2 UTSW 9 7833872 missense possibly damaging 0.81
R6941:Birc2 UTSW 9 7819468 missense probably benign 0.00
R7105:Birc2 UTSW 9 7819441 missense probably damaging 1.00
R7135:Birc2 UTSW 9 7818761 missense probably damaging 1.00
R7233:Birc2 UTSW 9 7827008 missense probably damaging 1.00
R7460:Birc2 UTSW 9 7818761 missense probably damaging 1.00
R8146:Birc2 UTSW 9 7818796 missense probably damaging 1.00
R8396:Birc2 UTSW 9 7834300 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTGCTTGCCGAACAGAGAG -3'
(R):5'- AGAAGCCCTTCAAGCTCAG -3'

Sequencing Primer
(F):5'- CTTGCCGAACAGAGAGATGAC -3'
(R):5'- GGGGACATTTGAAATTTAATGGAAC -3'
Posted On2019-10-17